Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25191  (registered. 2003)
Contig Information
Length 1086 bp
Clones 77 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 11
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 12
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 6
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 9
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1091
Evalue 5.09365e-117
Total Hit Count 493
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25191
AGTTCTATTCAACATAAAAACACAGGACAGGAATAAACTAAATATTTAGTTTTCAACTCATTACCTCCATCCAGAAAGTAACACGAACAAAATAAGATAG
CGGAACACTGGCTAGGAATGTCGACAGAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTGGCACATATATCATCTTC
TAGATATGAAGCAGCAAAATAGCAACTTCTATCCTCTACTCAGCAGCAGCAACCTCCTCTGCTCCAGGAATCACCTCATCTCCATCAGCAGGCCTGTCAA
GCTTCACACCAACATCCTCCTTGTAGTCACCGTGAACCTCCATGAGCTTCCCCAGGTCGAACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTACAC
GTTCTGGAGGGGGAAGATGCCTGAGGTGGCCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTTGCA
GCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCTTGG
TGAAGCCAATGGCGAACATGCGGAGCATGTAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTCCTCACAAGAGACCTGAG
CTTGTCAGTGGTGAAGTCCATGCCCCAGAAGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCCTCA
TCGTTCTGAAGATCAGCTAGAGATACTTCGAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGCGTCCTGGACACGAGGGTCTTGCCGA
CGTTGCGGCTGGTGAACAGCAGCGGCGCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTCTTGCTTCCCTTCCTCCCCTTGGA
GATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTTGAGCGTTCGGGG
page-top