Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25176  (registered. 2003)
Contig Information
Length 791 bp
Clones 73 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 9
Wh_V4816 Shoot grown under cold condition for 16days 28
Wh_V483 Shoot grown under cold condition for 3days 20
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 9
Wh_VWD Shoot grown with dessication 5
Homology (BLAST) Top Hit cold-responsive LEA/RAB-related COR protein [Triticum aestivum]
Score 568
Evalue 1.33566e-56
Total Hit Count 61
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25176
GCCGGAAAGAACACCACAAATTAGTACGTACCAACACTCCATCAACTTCAAAAATGTCTGGTTGGTTTCAAGAGAAGTCCGGCGACGCCACCAAGACGGC
GTCCGAGACGGGGCAGACCATTCAAGACCGCGCCGTCGAGGCAAAAGACCAGACCGGGGCCTTCCTTGGTGAGAAAAGCGAGGCTGTCACGAAGGCTGCC
TCCGAGACTACCGAGGCGGCTAAAAAGATGGGCGGCGAGGCCATGGGGAAGGCGTCCGAGACGGTGGAAGCCGGTAAGGATCACGCCGTCGAGGGCAAAG
ACCAGACAGGCAGCTTTTTCGGCGACAAGACTGACGCTGTCAAGAAGACGGCCACCGAGACTGCCGATGCCACCAAGGAGAAGTCCACCGAGGCCGCCCA
GCATGTCCAGGACACCGCTGCACAGTACACCAAGGATACCCCGGTCGCCCCCAAGGAAAACGTCTTCCAGCAGGCCGGCGGGAATATGGTGGGTGCCGCT
ACAGACGCCAAGGACGCTGTCATGAACACGCTCGGGATGGGAGGAGACAAGTGAGATGCGGGTGGTGCCACCAAGAAGACCACAAAGGATAATAGGCGCG
TCTGCGCTTGCTTGCCCTAGCCCTCCTTCTGTTTCGCTATTCCTTCAATATAATTTAATTTCCAGTTGCCATGGCACTAATTTACACATGCTCCTTGGTG
TAACCTTTGTATGATGTATCCGACCGAGGTATGAATATATTTTCCACCAATCATAATCAACACGAGTGATTTGGATGTTGCAAAAAAAAAA
page-top