Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25171  (registered. 2003)
Contig Information
Length 1922 bp
Clones 72 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 9
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 10
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 16
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 11
Homology (BLAST) Top Hit mtN19-like protein [Zea mays]
Score 712
Evalue 2.15417e-138
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25171
TGTGTTGAATTATATTGCGCTAACTGACCTAAAGGGTCTATATAAGGACATATCAACCTTGCCACGAAGCAAGAAATGAAATATCGAGTTCCTACCTATG
CTCTCTTCTACCCCTTCAATTCTCCAGTCCTTTTCCCTATAACCCAACGTCTACACGGCTACAACCTTCGCGTCCAGCGAGTATCCCACCCTAAAACCTC
CTTAGCCAACGTCAGCTACAACAACTTACTATTATATCGACACTAGTTTCTCTTATGGCGGTGATCAACTCATACAACTCAGCTTCATATACACGACTAC
TGATAACAATTAATTATAGAACATCAGGTCCATCGAAACGACATTGCTCACTGACTGGTGACTGCTTCTGTATATTAGCTAGTAATACTAGTATGACAAA
AACACATCCATCGTATAACTATGACGATTGATCCACGGTGATTGTTTCAGCTTCTCCACTCCTCACCATTTGCATTGCACTCCATTAGCTAGGGGTAGAT
GATAATCTACTCTTCACATGTTGCTAGACATCCATGCCGGTAGGCACCATGGGACTGGGAAACTGAAGCACAGGGATGGCGCCGGAGTCGGCTGCTGCGG
CTCGGCCACGAGGATGTAGACCAGGCCCATGACGCCGGTGTGCTGGCGGTCGCTGCTGTAGTTGGAGACGATGGTCAGCACCTCGCCGTCGCTGACCTTG
ATGGATCCTGGCTTAGGGTAGCACGTCGACATGCCAACGATGTAGTTCGCCTCGTTCCCTGCCTCCTTCCCCGTGCCGTAAGTTGGAAGCGATTCACAAA
GAAGGCGTCCGTCCTGGCCATGCAAAGAAGCACCGACTCCTCCGGAGTGCTGGTGCGCAACACTGAACACGATATCTCCTCCACGCGGCAAGGCCGCTCT
AGCAGTCTTAGTATGGATGCACTCATTGTTGGCTCGGTTTTCTGCGCTGCATTCCTCGACTTGATACTCAACCTTGCAAGAATGTTCAGGAGTTCCATCG
AGCATAGCGGTATCCGTAACGTCAAATATGTAAATCTTGACAGGCACCACCGCATCAGTCCAGTCGAGCCACGTCACGGTGTACTGCAAGAACAACTTCC
GCACCTCGCCATTGAACCCTTCTTTGACCCGACACTGGGTCTGATCATAGCAGCAAAATAGCCCCACCAGTGTAGTTCTTTGAGATTGTGCGCCCATACT
CATCAATTGTGACATTGTAAAAGTCGCACTTGCACTCGGTGCAGCTAGGCTTGTCGACCACGCCCCTTGTGTCGATGGCATGAATATTGAGCAACCATTT
CTCCTCATAGCCTTCAGGGGCCTTGTCTTCATTGCCAATCTCAATTCCATAAGGATCAGGAACCCATGTGGCAGTGTGGCGAGTCTCGGAACCGAGCCCA
AAGTACTGGCCTAGTGTGGTCTTGCACACTCCATCATTCCTTTTAAGCATCCCTTTTGGAAGATTTTGCGTATCGGGGCTCTGACTGTTCTTCAGAGCAT
AGTATGGTTCTGCAACCCAGTGATGCAGGTAAGTCTCATGGAGCGGGACAGGGACGCCATTCTCATCGACGACCTCTGCATCAAAGCTCTTGACTGCAAG
GTGGCCTCGGGGGAAGTCGACATCATGGTGGTACTTGTTTGAGACTGATCCAGGTCCCAATAAGATGGGCGGAGAACGGAACGTCTTTGATTTCAGCAGA
TGGCCTCTCACGTTGAGGGCTTCAGAGGGTAGGGGGGCGACAGCCGACAGGAGCGAAATGAGCAGCACAGCAGAGCCAGCCATTTTCATCTTGTCAGCAG
ACCAGCTTGCTTCGTGGTAATCTCCCCTGTGCCAATTCGATAATACAGAAGACAGTAGCTTTCACAGGTGACCAGGAGGGAGAGGGACGGAAGAGGACCG
AGGAGCGAACCAGGAGGAGGCG
page-top