Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25169  (registered. 2003)
Contig Information
Length 1466 bp
Clones 72 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 11
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 25
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit alcohol dehydrogenase ADH1D [Triticum aestivum]
Score 1845
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25169
TTTTTTTTTTCAAGTAGGCTAAGAACAGACTCATTCAACTGAAACTCATGGCCATAGTAGCAGCAGCAGCAGCAGCAGCAGCAGCATATATTGCTGCCAA
AAGAGAGCTCGTAGTACCACCACTTCTCCGGTACGTAATTACAGATATACTTGAACTAACACTACGCTACTTTGCCAAGGAAGGCGAAACCACAGACGAT
GATCTGGTTCAGAAACCGCCCCCCAAACGCTTATTACATCGGAGCAATCAGAAGCACGTGAGGCGGCCTAGTTCTCCATGCGGATGATGCAGCGGATGCC
CTCGCCCTTCGCCATGAGGTCGAACGCCTTGTTGATCTCCGAGAACGGCACGCTGTGTGTGATGAACTTCTCCACCTCCAGCTCCTTTCTCATGTACATC
TCCACGACATTGGGCAGGTCGGTGCGCGGCTTGAAGTTTCCGAAGAAGGTGCCCTTGAGAGTCCTCTCGTTCAGGAAGTTCATCGGGTGGGTCTTGAATT
CGGCGTCCTTGTGCGGCACACCCACCAGCACAGCAACACCCCAGCCATCATGGACACATTCAAATGCTTGTATCATAGCATTGACGTTGCCCGTGCACTC
AACACTGCGGTCAACTCCACCATTTGTCATCTCAGCGAGCACCTCCTGAACTGGCTTGCTGTGATCTTTCGGGTTCACAAATTCCGTGCAGCCAAATTTT
CTAGCTTCTTCAAATCTGCTGGCGTTCAAGTCAATACCAATGATCCTAGATGCACCTGCAATCCTTGCACCTTCTGCAGCAGCAAGGCCAACAGCTCCTA
GCCCAAATATCGCCACTGTCGAACCCTTTGGTGGTTTTGCAACATTAATGGATGCACCAAGACCAGTGGAAATACCACAGCTAAGAACACAGACTTTATC
AAGGGGGGCCTCAGGGTTGATCTTGGCAACACAACCAACATGCATGACAGTATACTCACTGAAGGTGGAAGTCCCTACGAAATGGTAAATCGGCTTCCCG
TCAATAGAGAAGCGTGACTTGCCATCCCCGATCATGACACCTCTGTCGGTGTTGATCCTGAGCAGATCACACATGTTGCTCTCCGCAGACTTGCAATGTG
GGCATTCCTTACACTCCCCAGTGAACACAGGAAGGACATGGTCACCAGGGGCAAGCTCAGTCACACCCTCTCCAACACTCTCCACTATGCCTCCAGCTTC
ATGACCGAAGATCCGAGGGAACATGGGGGTCTGCCCCTTGGCCTCCCAGAAGTAGACGTCGGTGTGGCAGAGGGAGGTGAAGAGGATCTTGACGCGCACC
TCCATGGCCTGCGGCGGCGCCACCTCCACCTCCTCCATGGACAGCGGCTTCCCCGCCTCCCATGCCACCGCGGCTTTGCACTTGATCACCTTCCCGGCCG
TCGCCATCTCGCTCGCCTGGGAAATTCTCTGAGCCCGGAATCGAAATCGAGAACTGATCTCTCACT
page-top