Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25167  (registered. 2003)
Contig Information
Length 1529 bp
Clones 72 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 9
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase [Triticum monococcum]
Score 1285
Evalue 2.61736e-139
Total Hit Count 352
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25167
CGCGCTAACTCGTTGCACAAGAATTCCTCCCACCCTCGCCGTCTCGCCGCCGTCACCACCGCAGCTAGATAAGAGAAAAAAAAGAGAGAGAAGAACTCGT
CGGGAGGGCTCGAGATCTGTGTTCGGAGAGGGGAATTCTTGAGGTCGGAATCGGAACAAGCGGGCGCGCTCGGGATCGGGGTTACCATACAATTTTTCCC
AGGAACCTTTAGTGAATGTGCTAATGGAGTCAAAGGGTGGCAAAAAGTCTAGCAGTAGTAGTTCCCTGATGTACGAAGCTCCCCTCGGCTACAGCATTGA
AGACGTTCGACCTGCTGGAGGCGCCAAGAAGTTCTCTGCTGCATACTCGAACTGCGCGAAGAAGCCATCCTGATATCGTTTTTGGCATCCCCTTCCCGTA
GTTTAGGATTTTTATGCAATTTTATTCTGACTCTTTTCTCCCACCAATCTCTCTGGCTTGCTGCTTCACGATAATCGACCAGTTCTCTAGTCTTTCTCCC
TCTGTTCCTCTCTGCTCTGCTTTCTGACTCAAAACTGCAACAATGGCTGCCCCGACCTCTGCGATCGGATTTGAGGGCTACGAGAAGCGCCTTGATATCA
CCTTCTCTGAGGCATCAATCTTTGCTGACCCTCATGGTCGTGGCCTGCGCGCCCTCTCCAGGGGCCCAGATTGACTCTGTTCTTGATCTTGCACGGTGCA
CCATTGTGTCCGAGCTCTCCAACAAGGACTTTGACTCGTACGGTGCTATCCGAGTCGAGCTTGTTTATCTACTCTCAGAAGATTGTGATCAAGAACCTGT
GGGGACTACCATGCCTCCTGCTCACCATTCCAAGGATTCTCGAGCTGGCTGAAGAGCTGTGCATGTCGCTTGCTGCTGTGAAGTACTCCCGTGGGGATGT
TCATCTTCCCCGGTGCACAGCCTGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTGAACCGCTACTTTGGCCACCTGAAGTCTGGTGGCAATGC
CTATGTGATTGGAGACCCAGCGAAGCCTGGCCAGAAGTGGCACATCTACTATGCCACCGAGCAACCTGAGCAGCCCATGGTCACCCTGGAGATGTGCATG
ACTGGGCTCGACAAGAAGAAGGCCTCTGTGTTCTTCAAGACTTCTGCTGATGGCCATGTCTCCTGTGCTAAGGAGATGACCAAGCTCTCTGGTATCTCTG
ACATCATCCCTGAGATGGAGGTCTGTGACTTCGACTTCGAGCCCTGCGGCTACTCCATGAACGCCATCAACGGATCTGCCTTCTCCACCATCCATGTGAC
CCCCGAGGACGGCTTCAGTTACGCGAGCTACGAGGTCATGGGCATGGACGCTTCGGCCCTGGCCTATGGCGACATCGTCAAGAGGGTCCTCCGGTGCTTT
GGCCCTTCAGAGTTCTCAGTGGCGGTCACCATCTTCGGTGGCCGCGGCCATGCCGCCACCTGGGGCAAGAAGCTCGACGCCGAGGCATACGACTGCAACA
ACGTTGTGGAGCAGGAGCTCCCCTGTGGA
page-top