Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25165  (registered. 2003)
Contig Information
Length 899 bp
Clones 71 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 19
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 20
Wh_VWD Shoot grown with dessication 15
Homology (BLAST) Top Hit RecName: Full=Thioredoxin M-type, chloroplastic; Short=Trx-M; Flags: Precursor >gi|4138592|emb|CAA06735.1| thioredoxin M [Triticum aestivum] >gi|56709480|emb|CAI35908.1| thioredoxin M precursor [Triticum turgidum subsp. durum]
Score 935
Evalue 4.63143e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25165
CATTCACATCTTTTTCCCTCTCCTCTCCGGGGTACTGGCACAGGAACCAGCTTCTTTTTTCTCTTTGTTTCTCCCACTGTCTCCGTGACCAGCAATGGCC
TTGGAGACATGCCTCAGGGGCTGGGCCCTGTACGCGCCCCAGGCTGGCATCAGGGAACGGCTTAGCAGTGGCAGCTACGCGCCATCCCGGCCAAGGACCG
CCGCCCCCGCCGTCGTCTCGCCGTCCCCATACAAGTCCGCTCTGGTTGCGGCACGGCGGCCGTCTCGCTTCGTCTGCAAGTGCAAGAACGTCGTCGACGA
AGTGATTGTGGCTGACGAGAAGAATTGGGATAACATGGTGATCGCGTGCGAGTCGCCGGTGCTGGTGGAGTTCTGGGCGCCGTGGTGCGGGCCGTGCCGG
ATGATTGCCCCGGTGATCGACGAACTGGCAAAGGACTACGTGGGGAAGATCAAGTGCTGCAAGGTGAACACGGACGACTGCCCAAACATCGCATCCACCT
ACGGCATCCGGAGCATCCCCACCGTGCTCATGTTCAAGGACGGCGAGAAGAAGGAGAGCGTCATCGGCGCCGTCCCGAAGACAACCCTCTGCACCATAAT
CGACAAGTACATCGGCAGCTAATTAATCATTCTTAATTAGCGATTAATCGAGGACGCACACACCTTTACTGTTCTGTTCGCGAGACAGCATATATGTATG
TATATGATGCGCGTATACGATCCACCGACCAGTTGTGACTTGTACTATTCTTAATTCTGATGCAAATCAAAACTGATTTATTCGGGCACGTCAGTATACA
TGCATGTTCGTAAATCTGTCTTGACATCCTTTCTGTAGCAAAGGACAAAAGATTTTGATATATACTATAAGAGCAAGTGATTAATTTTCAAAAAAAAAA
page-top