Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25161  (registered. 2003)
Contig Information
Length 1200 bp
Clones 70 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 11
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 9
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 8
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 1541
Evalue 3.91047e-169
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25161
TTTTTTTTTTGGAGAAATTTTGTAATTTGAAACATAACGTAACAAACTCAAGACTTAGATGAACAATTCGCCACTCAGTTTACAATACACACCGGACAAA
CCGCCTCAAAAACCACCAAATCAAGGGATGAGCACATGGCGCCGAGAAACAAACTAGCCTAGCCAACAAGTGGATACGAGACCCAGATTATTCAAAGTAA
ACACGGCTATGGTGGTGACATCCTCCTTGCAATTAAAAGGGGGGCTCTGCTATACGAGCACGGCTTACTGCGCCTTGGCGAGCTCGGCACGGATCTGCTT
GGCGGCCTCAACCATGTTGGTGAGGGCAGGCTTGACCTCGGCGTACTTGCGGGTCTTGAGACCGCAGTCAGGGTTCACCCACAGGATGTTGGTGTCCAGG
ACCGCGAGCATCTTGTTGACACGGTCGGCAATCTCCTCCTTGGACGGGATCCTGGGGGAGTGGATGTCGTACACACCCGGGCCAATGCCAGCACCGTACA
CCACACCCTCGCGGAAGACGGACAGAAGCTTCTCGTCGGACCGCGAGTTCTCGATGGTGATCACATCAGCGTCCATGTTGATGATGGACTGGATGATGTC
GTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGTGGTGTCCTGCACACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAA
GCATGCTCAGACTTGCGGAGTGGCAGACCCTCTCTCAAAGCAGCCTCGTCAATTTGGATGACCTGAATACCACCAGCCTCAAGGTCCTCGACCTCCTTCT
TGATTGCAAGAGCAATCTGGTAGCAAGTCTCAAACCTCGGTTGGTCATTTCTAACAAAAGACCAGTTAAGGATTGTGACAGGGCCTGTCAACATTCCCTT
CATTGGGCGAGCAGTCATGCTCTGTGCCATCTTGGACCAGAACACAGTCATGGGGTTGGGGCGGCTCACATCACCGTAGATAATCGGTGGCTTGACACAC
CTTGATCCATAAGATTGCACCCAGCCATTGGCAGTGAATGTGAAACCAGAGAGCTGCTCACCGAAGTACTCAACCATATCGTTCCTCTCTGGCTCTCCGT
GCACAAGCACATCAATGTCAAGCTCTTCTTGGATCTTAACAACCTTGATAATTTCCTCCTTGATGGCATTGGTGTACTCCTCCTCAGAGATCTTCTTTGC
page-top