Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25159  (registered. 2003)
Contig Information
Length 2429 bp
Clones 70 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 17
Wh_KMV Shoot grown with continuous light after cold treatment 10
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os06g0133800 [Oryza sativa (japonica cultivar-group)] >gi|113594751|dbj|BAF18625.1| Os06g0133800 [Oryza sativa (japonica cultivar-group)]
Score 3245
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25159
ATTGCACTGATGATACTATGCATCAAACCGTTTGTATGGGGGAAGGGGAAGATGAGCAAACTACCAAGGACTAAAAGGGCGCATCAAAGCATAAAACCCA
TGGAGGCGACGATCTCGGGGAGAGAAAGAAGCATCGCAAGCACGACCATCAGTTCGATGTAAACAAATACAAAAAACCAGTCCCCAATTTGATCAGGCTC
GCCCCCTCCGCGAATCATCTAAGGGGGGCGATATATATCGAATGTAAGACAACGCAAATGGAAAAGGCATTGTTTATTACAGGCCTAAAAATACCACTCA
CGCTCCGACGCAGGCATATCCTCCTCTCCCTCCGTTATTCCAAAGCTTCTGGGCACGAGACCTTCACAAGTGTGGTGTTTGTTCTTTGGCATCAACGATG
ACAGAACCTCGCAGAGTGTGCTGATCTTACAGGCTCTTGGCTGCGGCGATGACGTTCTCCGCGGTGATGCCGTACTCCTTGTAGATCTTCGGGGCAGGTG
CGCTGGCGCCGAACTTGTCGATGCCGATGGTCTTGCCCTTGGACCCGACGTACTTTTGCCATCCGAGGGTAGACCCGGCCTCAATGCTGATCCTTGCGGT
GACGGCCTCAGGGAGCACGCTCTCCTTGTACTCATCTGACTGCTCGTCGAAGAGTTCCCAGCAAACAAATGACACAACACGGACGGTCTTCCCCTCCTTC
GTCAACTCTTCGGCAGCCTTCACGGCAATCTCTACCTCAGAACCAGTGCTCATTATGATGTAGTCAGGCTTGTTGTCGGTCGAGTTGTCAGAGATGGTGT
ATCCACCCTTCGCAACGCCCTCAATTGAGGTACCAGGCAGATGAGGAAGCTTTTGCCTGGAGAGAGCCAGAATAGATGGCCTCTTCCTGTTGAGGACAGC
CACCTTGTATGCCCCGGCAGTCTCCTTGCCATCAGCAGGACGGAACATCAGCATGTTTGGCATCGCACGGAAGCTCACCAAGTGCTCAATGGGTTGATGG
GTCGGACCGTCTTCACCCAGACCAATAGAGTCATGGGTCATGACATAGATAACTCCAGCTTCAGACAAGGCTGAGATCCTCATGGCACCTCTCATGTAGT
CAGTGAAAACAAAGAAGGTTGCACAGTATGGAATGAGCCCTGGGGTGTGCAGCGCAATGCCGTTGCAAATGGCGCCCATTCCGTGCTCCCTGACTCCAAA
GCGGACATTGCGCTCCTCAGGGGTATCCTTCTGGAAGTCGCCAAACATCTTAAGCAATGTCATGTTGGAGGACGCAAGATCAGCACTGCCTCCAATAAGA
CCAGGCACAACTTTAGCAAGTGCATTCAAGCATTGCTGGGAGAGATTCCTGGTGGCATCTGCTGGGCTCTCTGTGGTGTATTGAGGAAGAGCATCGGCCC
AGCCAGCGGGCAACTCTCCAGTGATAATACTTTTCAAGGTGGCGGCATCTTCTGGGTACTTCTGCTCGTACTGTGCAAACTTAGCATCCCAGTCAGCCTC
AAGAGCGGCACCTTGGGGAATATGGCGGCTCCAGTGGCTCTTGACATCCTCGGGCACAAAGAATGGCTCATATGGCCATCCAAGGTTTGCCCTGGTTGCT
TCGACCTCGCTGGTGCCCAATGCAGCTCCGTGCACAGCGTATGAGTTGGCCTTGTTGGGAGATCCAAAACCGATTGTGGTAGTCACCTTGATCATTGTGG
GCTTGTCAGTAACTGATTTTGCTTCCTGAATGGCTTTACGGATCTCGTCATAACCATCGTTGCCATTCTTAACCCAGAGGGTGTGCCACCCAAGAGCCTC
AAAGCGGCCACTCACATCCTCTGTAAAAGCAATCTCCGTGTCTCCGTCAATGGAGATGTGGTTGTCGTCGTAGAAAACAATTAGCTTGCCAAGACCCCAA
TGCCCAGCCAAAGAGCAAGCTTCAGTCAAGATACCCTCCATGTTGCACCCATCTCCCACAATACAGTACGTGTAGTGGTCAACGATTTCACTGTCGGGCT
TGTTGAAACGAGCAGCCAGGTGCTTCTCAGCAAGCGCCAACCCGACGGCATTCGCGATACCCTGGCCAAGAGGACCAGTGGTGACTTCAACTCCAGGAGT
CTCGAAGTTCTCAGGGTGGCCGGGGGTGGAGCTTCCCCACTGTCTGAACTGCTTCAGGTCCTCTTCCTTGACGGCGTCGTAGCCGGCGAGGTGGAGGAGG
GCGTACTGGAGCATGCAGCCGTGGCCGGCGGAGAGGACGAAGCGGTCGCGGTTGAACCAGTAGGGGTTCTTGGGGTTGTAGCGCATGACCTCGTCATACA
AGATGTGGCCCATGGGCGCGCACCCCATGGGGAGGCCGGGGTGGCCGGACACGGCCTTCTCGACGGCGTCGATGGCCAGGAACCGGATCGCGTTGACCGA
CTTGTCGAGCAGCTCGCCCGGGCGGCGGC
page-top