Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25155  (registered. 2003)
Contig Information
Length 1676 bp
Clones 69 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 12
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 6
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 19
Homology (BLAST) Top Hit Os11g0171300 [Oryza sativa (japonica cultivar-group)] >gi|78099750|sp|Q40677|ALFC_ORYSJ RecName: Full=Fructose-bisphosphate aldolase, chloroplastic; Short=ALDP; Flags: Precursor >gi|62732953|gb|AAX95072.1| Fructose-bisphosphate aldolase class-I [Oryza sativa (japonica cultivar-group)] >gi|108864046|gb|ABA91630.2| Fructose-bisphosphate aldolase, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644566|dbj|BAF27707.1| Os11g0171300 [Oryza sativa (japonica cultivar-group)] >gi|125533557|gb|EAY80105.1| hypothetical protein OsI_35277 [Oryza sativa Indica Group] >gi|125576361|gb|EAZ17583.1| hypothetical protein OsJ_031792 [Oryza sativa (japonica cultivar-group)] >gi|215740860|dbj|BAG97016.1| unnamed protein product [Oryza sativa Japonica Group]
Score 946
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25155
TTTTTTTTTTGCGCATCAACTAGACCATTGTATTTTGCACAAATATTAAAGACAAATAATCCAACGATTCTAGATTTAAATGCGAGATAGTTATTTTACA
TCTAGATGTGAAATAGCAAACCCGATAGAAATAATATCTCAGAAAAATTACCGCGTTCCAAAGGGGGGGCGCTTCAGATTGTTCATACTTACGGTAGCAA
ACAAAGGCAACAATGCTCTAGAAAAAACCATGCGAATACAACAGTAGGACCATTCCAAAGTAGTTTACTTAGGGTGGCAAAACACAGTATATACTCTCTG
TCCATCTCTTCCATCAGAGCTGGTCTCGACCTGTAACAACGACGACCCACTGGCTGGCTAAGGCGCCCTCAAGCTGCTCAAGGCGCTACTGGCTGACAGT
GATGCGGTAGATTATTAGATAGACAGCTCGCCGACGGATCAGTAGCTGTAGTTCTTGACGAACATGTTCTCGCTGGCTTCCGCGGCCTCGCCGTCGCTGG
TGTACTTGCCGAGCTGCGCCAGGGAGTTGGCCTTGGCGCGCAGCAGCAGCGCCTCCTGCGCCGCGGCCACGTTCTCCGGCCGCCCGCCCCACGTCTTGAG
GCAGGTGTTCTGCAGCGCCCGCGCGTAGGAGAAGGACACGTGCCACGGGTTCGGCGCCTGGTTCATCGCGTTGAGGTTCAGCGTTGCCTCAACCTCCGAC
TGACCGCCAGACAAGAACATGATGCCGGGGACGGAAGGGGGGATCCTTCTCTGGAGGAGCTTGAGGGTGTAGCTGGCTACTTCCTCAGGGGTGGCCCTGT
CCTTGCACTCAGCACCAGGGGTCACCATGCTTGGCTTCAGGAGGATGCCCTCAAACATGACGTTGTTCTGAGCCATGTAGTAGAAGGTCTCCGCCCACAC
CTTCTGTGCGACCTCGAAGGTCCTCTCGATGCCGTGCTCACCGTCGAGCATGATCTCAGGCTCCACAATCGGCACCAGCCCATTGTCCTGTGAGATGGCC
GCGTAACGGGCAAGACCCCCAGGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTAGGAATGCTGACAACAGTGCGCCACTTGGCGAAGCGAGCGCCT
TGCTGGTAGTATGCTGCTTCACGGGAGGCAAGGCCATCGAGACCTTGGCACCACGACTCATCATTGGAACCAACAAGTGGCACAAGACCCTTGTCAACCT
TGATACCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTTCCATCAACAGTCGACTGGTAGAGCGTCTCCTCAAAGAGGATAGCACCAGA
GATGTAGTTTCCCAAGCCTGGTGGAGTGACAAGAAGGGTCCGGTAAGCCTGGCGGTTAGCCTCGGTGTTCTCAAGGCCAATCGAGGCAAGTCTCTTGCCA
CAGGTGGCATTCGACTCATCCATGGCAAGGATACCCCTGCCTGGCGATGCGATGGTTTTCGCGGTTTTGACAAGCTCATCGGCGTATGCGCTGGCACGGA
CAACCATGGAGACGGTCACCGGCTTGGGGGCGGCGGCCTGGCGCGTGGTGCCCCATTCGGCCTTCTTGGGAAGGAAAGACGATTTGAGGAGAGTAGCAGA
CGCCATTGTTTCTGGAAGCAAGCAGATCAGGTGCTACCCTCTTCTTTGACACGCCTTACAATTGCCCTCGTGCCGA
page-top