Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25153  (registered. 2003)
Contig Information
Length 926 bp
Clones 69 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 10
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 9
Wh_V483 Shoot grown under cold condition for 3days 8
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 14
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit hypothetical protein OsI_06639 [Oryza sativa Indica Group]
Score 546
Evalue 6.25041e-54
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25153
TTTTTTTTTTGCACAATCCAAAGCTAACATGTCCACATTGTAATTAAATGCTTTCCCCTGTCTTTCTGCACAATCAAGATAATACAATTGGATTTCAAAG
GAACACAAGAGCTGGCGGAATAAACAAAAGGATGGAACCAACCACTCGACGAATGGCAGCATTTCGAGTACATTAACTTGGGGAAGAGCCTCACTTGGGG
AACAGTGGGGAAAATGCTCTTGCACTCTAATGTACTACCAAGCATTTGTAACTAAACAACTTACAATTACACTTAAGCTGGAACTTGAAGTATTGGATCA
GCAGGGAATTCCTCATATCCACTTATGCCAGTAATTCTTAACCTCGTATTTGGCTGTCTGTGACCAGCTTTCCTCTGGTACTTCTTCTTCTTCTTGAACT
TGAAAACAATCACTTTATCGTCCAGTCCCTGTTCTTCAACAATTGCATGAACAGCAGCATTGGTCACCACTGGCATGCCAATATAAGCTTTGTCTCTAGT
TGACACCAGTAGTACCTTGTTCAAAATGATCTGATCATTGACATTGGCGTCTTTCAGCCTCTGTGTGTATATGTACCGACCTGGCATCACAATGTATTGT
CTGGACCCAATCATGACAACGGCGAAGATGTCGGCGTCCTTCCCCGCGCCAGCAGCAGCCAGCTGCACCTCAACAGGCTCCGGAACCGCGGCATCCTCTA
CCACCTCCTCCGCCTCGGCTTCCACCGGAGCGGGCGCCTCCTCGGCGGCGGCGAAGATGCGCCAGTTGCGGGGCGCGGACGCGGTGACGGAGAGAGAAGT
GCTCGCAGGGAGGAAGGCGGCGGTGTGGAGGAGTGGGGTTCTCGAGGGGAGGAGGCGGAGAGGGAGCGTGGCGGTGGCCATGGACGGGGCGCGGGACGAT
GGCGAGGGGGAACGACCGGCACGAGG
page-top