Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25151  (registered. 2003)
Contig Information
Length 1411 bp
Clones 69 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 8
Wh_EM Dormant seed with water absorption 8
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 6
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 11
Homology (BLAST) Top Hit ribosomal protein L3-B2 [Triticum aestivum] >gi|118152404|gb|ABK63946.1| ribosomal protein L3-B2 [Triticum aestivum] >gi|146141394|tpg|DAA01145.1| TPA_inf: ribosomal protein L3B-2 [Triticum aestivum]
Score 1993
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25151
TTTTTTTTTTACGACTCTAAATAGGTTTCAACAGCTAAATCACAATAACAGTAGCACATGACACGAAGAATTCATAGATGAGCCAGATTCTGAAAACATC
ACCTAGTACAAAACTTAGGCAGGGGAAGTAACCAAGTATCACATGTTCGTTTTGACAAAATGATACAACTGATGATGCGGGGCAGCAGCTCAAGCCTTGA
GCTTGCCGTAGAACCTCTGCTTCTCGTCCGTGGTCTGGAAGCGACCGTGCCCAAACTTGGAAGAGGTGTCGACGAACTTGAGCTTGATCTCCTCCAGGGC
CAGACGAGAGGTCTGCTTCAGCAGGGACTGGCGGAGGGTCACCACCCGCTTCTTGGGGCCGACACAGCATCCCTTGATCATCAGGTAGTCAGCCTTCACC
ACACCATAGTGAGGGAAGCCACCCATGGGAGTGATGTCCTTCTCAGTCCTGTCGAACTCGGTAGAGGCATCATGAGTTTCCTGTCCAACCTTGCCAATCT
TGTAGACCTTCTTGTTCATCTCAGTTCGGTGGTGGTAACCATTCTGACCAGCACGAGCAACAGTGTAGGACACCCTAGCAGGATGCCAGGCACCAATACA
GGCAACCTTGCGAAGACCTCTGTGGGTCTTGCGGGGAAGACGGGTGACACCCCAACGTGTCACAACACCTTCGTAACCCTTACCCTTGGTAACTCCAATG
ATGTCAATCATCTCATCCTTTTGAAACACAGCATCAATAGGGACTTCCTTCTCAAAGAAGCTGTAACCATAGTCAACCTTATCGGCGATGGTGCCACCAT
TGATCTGGATCTCCATGAGGTGAGCCTTCTTCTGCTTCAATCCCTTCATCTTCCTGATCTGGGTATGGGCGATAACACGGACAACAGTAGCATACTTCTT
CATCTTCTCAAGCTGCATATGGATTTCTTTTTTGCCAGCATCACTGTCATACTTCAGAGCATACTTGGTGAAGGCCTTCTTCTTGCTCTTGCACCAGTTC
TTGTAGAACCTCCTCCTGACATCTTCGCTGAGATGCTGTGCCCAGACTGAGTTGAGAGTACGAAGGCCACGAGGAGTCTTCACATAGGCAACAAGTCCAA
CAATAACAATCGGGGGTGTCTCAACAATGGTGACAGCCTCACATGTCTCCTTCTTGTGCAGCTTGGAACCAGGCTTCTCGACCTCACGCACAATGTGAGT
CATCCCAGATTTGTAGCCAAGGAAGGCAGTGAGGTGGCATTTCTTGGATTGGTCATCTCTGGGGAAGGCCTTCACCTTTCCGCGGTGGCGCGAGCACCGC
TTCCTGGGGAGGAAACCGAGGGATCCGTGCCTCGGGTGCTCGAACTTACGGTGCGACATCTTCCCTTCCTTCCCCTGTAGAGGTGGAGGCGGCGGCGGAT
GGGGGAGGGTG
page-top