Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25145  (registered. 2003)
Contig Information
Length 772 bp
Clones 67 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 3
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 14
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 15
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit putative membrane protein [Triticum aestivum]
Score 718
Evalue 5.1504e-74
Total Hit Count 46
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25145
GTAGCAGGTAGCACCCACCAGGAAATAAGAGCTAGCCGGCGGGTGCTCCACACGGAGACGTACGACCATTCGCATCGCAGCACACCAGCTTAGACATGGG
CCGCCGCCACCTCCACCGTCTCCGGCCTCGCCGGCGCCGCGCTCACCCGCCGGCCAGCCTTCTCTACCAGCTTCACGAGTGGTGCCCGGGTGTCGGCGAG
GAACCCGCTGATGACGAGGAACCTGGAGAGGAACGGCAGGATCACCTGCATGACGTTCCCGCGGGACTGGCTGCGGAGGGACCTGAACGTGATCGGGTTC
GGGCTGATTGGGTGGCTGGCACCGTCGAGCATCCCGCTGATCAACGGCAACAGCTTGACGGGGCTCTTCTTCTCCAGCATCGGCGAGGAGCTCGCCCACT
TCCCGTCGCCCCCGGCTCTCCAGTCGCAGTTCTGGCTGTGGTTGGTGACGTGGCACCTGGGTCTGTTCATCGCGCTCACCTTCGGCCAGATCGGGTTCAA
GGGCAGGACCGAGGACTACTTCCAGAAGTAGCGAATTAACTAGCTTTGGTTCGTGCATGTGCGTCGTCCTTGGGCTGCTCAAGGGCTGCTTCTGCGCATG
CGTGTTCAATGTAAAATCTGCCATGCCTTTTGGTTTTGTGCATGCGTGTGGCTTCGCAAGCCGTGTGATTGCTGTTTGTTAATTACCTCTTCCATGGTAA
GCACAAAAGAGTTCAACAACGACAACTACTACTACAACAACAACAATTTGTCACCGTGGCCTAAAAAAAAAA
page-top