Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25141  (registered. 2003)
Contig Information
Length 2097 bp
Clones 67 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 13
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1102
Evalue 4.50066e-171
Total Hit Count 274
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25141
TCTACCGCTGAGGTCATCAGTAGAGGATAGATACATCATCTGTCCATCCATCTATCCACATGGAACTGAAGTTTAACTGAACTCAGTGCTGTCTCCACAA
GAGAAGAGAAGAGAAGAGAAGAAAAAATATATAAGACTAGTATACATACATGCATGCATGCAATCTCCAACTCCAAGGAATTTCCTTTTTGCTAGTAGAA
AAGGTAGGAGAAGGAAGGGGGGATTGTGAGGCGGGTCAAGCAAGGAATCCGAGCTTCTCTCCGTTCTTCTTGGCGAGGCGGATCAAGCCCTGCCTCTGCT
TGGGGTCAGCGCCGATGGTCTTACNGAACTCGGTGATCACCTGGGAGTGCCTTTCTCCTTCTGTCCCGCAAACCCCCGAGAGATCACACCATGGTTCGGC
TTCGGTCACCACGGCCACCATGGCCAGAACCCCCCGGCCCACGCTCCGGCCGCCGCCGGCGGCAACCAGCCCACCTTCAAGATCTTCTGCAAGGCTGACG
AGGGCTACTGCCTCTCCGTCCGCGACGGCAACGTCGTCCTCGCCCCCTCCAACCCCCGCGACGAGCACCAGCACTGGTTCAAGGACATGCGCTTCAGCAG
CCAGATCAAGGACGAGGAGGGCAACCCCGCCTTTGCCATCGTCAACAAGGCCACTGGCCTCGCCGTCAAGCACTCGCTCGGCCAGTCCCACCCGGTGAAG
CTCGTGCCATTCAACCCGGAGTACCTCGACGAGTCCGTGATGTGGACGGAGAGCAGCGACGTCGGCAAGGGCTTCCGCTGCATTCGCATGGTGAACAACA
TCCGCCTCAACTTCGACGCCCTCAACGGCGACAAGGACCACGGCGGCGTGCACGACGGCACCACCGTCGTCCTCTGGGAGTGGGCCAAGGGCGACAACCA
GAGCTGGAAGATCCTCCCCTGGGGCGAAGAGGCCTACGCCGGAGGCAGCGCCAACGCCCCCCGCGGCGGCTCCTCAGAGCCCACCGTGCGCATCTTCTGC
AAGGCAGACGACGGCTTCAGCGCCACCGTCCGCAACGGCGCTGTGGTCCTCGCGCCCACCAACCCCCGCGACGAGTACCAGCACTGGTTCAAGGACATGA
GGCACAGCAACCGCATCAAGGACGAGGAAGGCTACCCGGGCCTTCGCCCTCGTCAACAAGGTGACAGGCGAGGCCATCAAGCACTCCCAAGGCGAGGGCC
ACCCTGTGAAGCTGGTGCCATACAACGCCAACTACCAGGACGAGTCAGTGTTGTGGACTGAGAGCCGCGACGTGGGCGCCGGCTTCCGGTGCATCCGCAT
GGTGAATAACATCTACCTCAACTTTGACGCTCTCCACGGCGACAAGGAGCACGGCGGCGTGCGCGACGGCACCTCCCTCGTGCTGTGGAAGTGGTGCGAG
GGCGACAACCAGCGCTGGAAGATCCTTCCCTGGTAAACGTGTCATGCTGCTGAAGCTGAGTTGATCGCCACCGTGACCCGGAGTTGGTAGAGATCGGCCT
GTGATCTGTTGCCGTGTCGTTAGAATAAAAGTCGTGTGCGGTTGGTGATGTGTCCGTGAGTGTGTGTTTAGTTTCTGTCCTGTCGTTGTGTCCTGCTATG
GCGAGCTATCCGATGTAATAAGCATTTGGCACTTGTGCTTGTTTTTCAAACCATGGATCGTGCCTCGTGCCGAATTCGGCACGAGGCGGTGATGGTGGCG
GAGGCGCGGACGTGTGAGTCGAGGAGCCACAGGTTCAGGGGACCCTGCGTGCGCAGGTCCAACTGCGCCAACGTCTGCAGGACCGAGGGCTTCTCCGACG
GCAAGTGCCGCGGGTTCCGCCGCCGCTGCTTCTGCACCACCCACTGCCACCATTAACAAGCCTCTCCTCCGGGTGATGCCTTCTTTCGGGTGGCCTTTCT
GCGATCGTCCATGCGTGCGTGTCCATGAATAAATCTCAGCTTGTCTCGGCGAGCTGGGTGCGAGTCCTTCTTTGTTTTTTGTATGATTATTACCGAACCT
GTGTGCACGCGTTGTTGTTTCTTGTTGGGTTCGTCCTCAGAGTTGCTGTGAGGTTTATGGGATTATCCCAGTCAATCCTTCTCTCATGTAAAATTTT
page-top