Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25136  (registered. 2003)
Contig Information
Length 984 bp
Clones 66 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 15
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 15
Wh_SHC Shoot grown with cold treatment 5
Wh_VHS Shoot with heat shock treatment 5
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit glutathione-S-transferase 19E50 [Triticum aestivum]
Score 1123
Evalue 8.50386e-121
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25136
TTTTTTTTTTCATCGACTAGAAAGACACACAAACATCTTATTTAAGGCTTGCCAAGCGACAAATCTGAAAGCATTACGAAGACATTGTTCCATCTCAAGA
GTTTTCACGACCACACACACGCAAAGCGCAAAAACTGCACGCTGGTGCAATTCCAGCCACACACACACGAGCTCATTTGCCTTATTCGCGACACCAACAA
GAAAAGAAAACGCCACACAGATCAGTGATCGGAATCGGATCCCACGATGCGAGATCCCGCCTAGCAAATCACGGCTTCTTGGGAACCATCTGCGCGGCGA
GCTTCTTCACGGCCGGCCTCGCCATGATCCTCTCCCACCAGGCCTTGACGTGCGGGTACGAGTCGAAGAGGGCCGCGTGCGGCGTGGCCATGAAGTAGAA
GGTGTAGGGGAAGTGGTTGAGGTCCGCGAAGCTGACGAAGTCCCCGGCGAGGTAGTCGTGCTTGGACAGGCGCGCCTCGTAGACCTCCAGCACCTTCTTG
AGCTTCTCCAGGCTCTCGTCCACCACCGTTTGGTTGGTCGGCAGGCCGCGCATGAGCGGGTTGATGAGGCACTCGTACACGATCGGCGAGATGGCCGGGT
TGTAGGTGTGCGCGTCCACCTCCGTCCATACGTCCACCATCGCCGCCTCCTTGAGGTCGCCTTCCCTCAGCAGGTCCACTTCGTTCTTCTTGTACTTGCG
GAGCACGTACCTCGCAATTGCGCGTGACTCGAAGAGAAGCAGATCCCCATCCTGGAAGGCAGGGATTTGGCCGAACGGGTTTCTGACGAGATGCTCGGGG
CTCTTGTGCTCCATGGCCTTGAAATCGATGTCGACCACCTCGTACTCGGCGCCGACCTCCTCCAGGCACACCAGCACCCGGGCCACGTTGGTCGACATCG
CCGGCCCGAACACCTTCACCGGCGCCATTGTTTCCCTTGGTTGCTAGTACACGCGAGGGAGTGAGGGATCGGGGTGTGTGTCTG
page-top