Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25133  (registered. 2003)
Contig Information
Length 768 bp
Clones 66 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 8
Wh_EMC Dormant seed with cold treatment after water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 16
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 9
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs
Score 374
Evalue 3.46978e-53
Total Hit Count 448
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25133
TGGGAAATTATACAGGAAATAAGGTAAGTCGAAGGATGGTAAAGATACCAACCAATACGGTAAGACCAAACGCAAAGCTCAAATTAGCATCAACACAAGT
CACTTCGATTGCATCAAATTCATGAAAGTGCGCGGCGATATGGTAGGCAATGGAGCCACTGAGCCCCTTTGCTAAGTAACAACTACAAAACTCCAATAAC
ATAAGAAACCACGACACAAGCGCCTACTGCAGGACCGTCCCTCTGACTTATATGATGCCGATCTTGTTGGCCACGTCAAGAGCATCATAGTCTGGTGTCA
GCTTCACGTACGCCTTCTTCTTGCCATCAGGCCTGATCAGGGTGTTAACCTTCTTGGCCTGGATGTCGTACATCTTTTTCACGGCAGCCTTGATCTTTTT
TTTTGTCTGCCTTCAGGTCGACGATGAAGACAAGGGTGTTGTTGTCTTCAATCTTCTTCATCGCAGACTCAGTGGTAAGCGGGTACTTGAGTATCTGGTA
CTGGTCTAACTTGTTCCTGCCAGGGGTGCTGATCCTGGGGTACTTGGGGTCCCTGGCCTTGGACAGGGTCTTGGGGCGGTGAAATGTCACAGACGTGCGG
ATCTTCTTTGCGGTCTTCTTGATTGACCCGGACTTCACAGCCTTGGCAACCTTGGCAGCCTGGGCCTTGGCATCGCCCTTCTTGGCAACAGCAACTTTGG
GAGCCATTTGAGCTTCTCAGGACAGCCTCTTGAGCTTACCTTCCTGGGGTGCGGGCGCGAGGCGATCG
page-top