Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25127  (registered. 2003)
Contig Information
Length 1247 bp
Clones 65 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 9
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 7
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 6
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit apoplastic invertase 1 [Hordeum vulgare subsp. vulgare]
Score 691
Evalue 1.49894e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25127
CCACTCTTTGCCCAAGCCCCCTACTGCCGGCGGCGGAGACGACGGAAACATGGTGCAGCGCCTGACCTACCGGAAGAGGCACAGCTATGCCACCAAGTCC
AACCAGACGCGGGTCGTCAAGACCCCAGGTGGTAAGCTAGTGTACCAGTACACCAAGAAGAGGGCGAGCGGCCCCAAGTGCCCTGTGACCGGGAAGAAGA
TCCAGGGGATTCCCCACCTCAGGCCTACTGAATACAAAAGATCAAGGTTGTCTAGGAACCGCAGGACTGTGAACCGTCCCTATGGTGGAGTGCTCTCTGG
AACTGCAGTGAGGGAAAGGATCATCCGCGCTTTCTTGGTTGAGGAGCAGAAGATCGTGAAGAAGGTGTTGAAAATACAGAAGACCAAGGACAAGACGACC
TCAAAGTAATCTGTTTGAAACAGAAGTGCGAAGTGCGATGGTGTTCTGTAAACAAGGAAAATATTTTTGTTGGTGGTTATGATCAATGGTTTAGTCCCTT
CTAGCTAAATGTTTTAGAGTACTTGAAATCCTTCTGCCGCCGTGACATCAGAGATTGTGAAACATTTGATACCCATTTGCAGTTTCATTTCTGAATGCAT
GTTGAATCTCGACGTGGAAGGCGGCGTGGGCCCCTTCGGTCTGTGGGTGCTCGCCTCGTCCAAGCTGGAGGAGAAGACGGCGGTCTTCTTCCAGGTGTTC
AAGGCCGCGCGCAACATCAACAGCACCAAGCCGGTGGTCCTCATGTGCTCCGACCCCACCACGTCATCTTTGAACCCGAACCTCTACAAGCCGACGTTCG
CAGGCTTTGTTGATACTGACATAGCGAAGGGCAAGATATCTCTGAGGAGCCTGATTGATCGGTCCGTCATCGAGAGCTTCGGGGCAGGAGGCAGGACCTG
CATCCTCTCCCGGGTTTATCCAACGCTCGCCCTAGGCAAGAACGCTCACCTTCATGTTTTCAACAACGGCAAGGCGGACATCAAGGTGTCACAGCTCACG
GCGTGGGAGATGAAGAAGCCAGCGCTCATGAACGGTGCTTAGAATTTAGGGTGGATATCTACATGCAGGCTTCCTATACATGTGCCTGAATTTGGCTCAC
GTTCTGTTAAATTGGTCTCTGGTGAAACATGATTGGTCTGTGAGGGTACGTATGTAGCTAGGTTTGCACGTAGTATAAGTGCACTACGAAGGGATCATTT
TGCCCGTAGGAACAATAAAAGTTCTATGCATATTCTGTCGTGCGCAT
page-top