Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25119  (registered. 2003)
Contig Information
Length 1496 bp
Clones 63 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_OKCS Seed DPA5 8
Wh_PCDAM Anther at meiosis 12
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit 60S ribosomal protein L21 [Zea mays]
Score 835
Evalue 3.87735e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25119
TTTTTTTTTTAATAATCAAAATAACGCAAGGCTTAGCAGCCAGGGAAGTAATTTGACGAAAATCAAGGGCAGCACTTCAGCTGCAAGTTTACTGAATTGC
ATCACGACAGAAAGTCTGGCAACAATCATATCAAGTTCATGATGTTCGAGGTAAAAATCTATCATCACACCATAGAAGACAGTTCTACTTTAAGATTTAT
CCGATAACATGGAAACTCTTAACATCCTCTCCTACTGCATTAAAGCAGCTGATGACTTCCGCACCATCTGAATCACTCGTGGAGGGTGCCCAGAATGTCG
TCGTCTCTGTAGAGGAGGTACTCTTTCTCAGGAGCAAGCTTGACTTCAAGACCGCCATACTCAGGCAGGAGCACATGGTCGCCTTCCTTGAGAGCAACAG
GGATCAGCTTCCCTTCCTTGTCACGGCTGCCAGGGCCAACAGCTATCACCTTACCAGAGTTCAGCTGCTTGGAGGTCTCCGGGAGGAGGATGCCGCCGGC
GCTCTTCTTGGGCTGCACCACCTTCTCCACCAGCACCCGGTTGAAGGACGGGATCAGACGCCGAATCGCCGCCATCGCCGCCGACGAGATCAGACGCCGC
TCTTCTCCTTCTTCTTGGGAAACAAGCAAGAAAACGCGACGCTTCCACCCTCGTGCCGAATTCGGCACGAGGCACCAACCACCCTTCTCCCGCCGCCGCC
CCGCGAAGCAAAGCAGGAGGAGCAGGATGCCGGCGGGCCACGGTCTGCGGTCGCGGACGCGCGACCTGTTCGCGCGCCCGTTCCGGAAGAAGGGTTACAT
CCCGCTCACCACCTACCTGCGCACCTACAAGGTCGGCGAGTACGTCGATGTCAAGGTGAACGGCGCCGTGCACAAGGGTATGCCGCACAAGTTCTACCAC
GGCCGCACCGGACGCGTGTGGAACGTCACCAAGCGCGCCATCGGCGTCGAGATCAACAAGCAGGTTGGAAACCGCATTATCAGGAAAAGGATCCATGTCC
GTGTTGAGCATGTGCAGCCATCCAGGTGTGCGGAGGAGTTCCGCCTGAGGAAAGTGAAGAATGACCAGCTCAAGGAGGAAGCCAAGGCACGTGGTGAGGT
CATCAGCACCAAGAGGCAGCCGCTCGGCCCTAAACCTGGGTTCATGGTTGAGGGTACCACAATCGAGACCGTCACTCCCATTCCGTACGATGTGGTCAAT
GATCTCAAGGGTGGTTACTAGGGTGTTTGGGTTATCTGCCTGCACAACCAGTTCAAATCTATGGTGCTCTTATGGGTTGGATTTGCTCTCTGAGCAGTAG
TCTGGGTTGGGTCTTTATTCATGTCAAGAAGATTTTCGGTGTAGGTTGCTATCATGAGTTTTGCAGAAATGCTATACTGTGCTATTTCCTTAAGAATGAT
GATGTGCTCTTTTGAACTATGTAGTTACATTGCTTACCTCCGAAGGTTCTCTTTGCCTCTACAGCCCTTGGTACTGCAGAGCTGCTGCAGCTTGCT
page-top