Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25117  (registered. 2003)
Contig Information
Length 637 bp
Clones 63 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 19
Wh_V483 Shoot grown under cold condition for 3days 42
Homology (BLAST) Top Hit hblt14.2 protein [Hordeum vulgare subsp. vulgare]
Score 255
Evalue 1.69053e-20
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25117
TTTTTTTTTTGATAGGGTATGTTCATTCAAGAAGACGATCACACATTCGCACTGACAAAGTATTATGTATTACGTTGATGGTACGTACATGTAGCACACA
AAGGAGCGAAAAATAGAGACATGGACTGAGAGGAAATACAGATACAGACACTCATTAAGGAACGTGGACATGAGCGAGACGCCGGTGTTTTTCTTCCCGG
CGATGTCAGCTATAGAAGTCTAAATCCCACAAGTTCAGCTTCAGCTCGTATGTATGTAGGTCAGAACATGAACTAGAGATGATCATGGGTGAGAAGGGAC
CCCAGGAATCACCACCAGCGGGCCGTTAATGGTACTGGTTCCGGTTCCCACAACCGGCAGGTCTGGCAACCCCGAACCCGAAGAAGCCTTGGACTCGGCG
ACGCCGGCACCGCGTGCCGTTGTGAGTGCCTGGTCCTTCTGGTTCAGCTCCCTCCCGTCGCAGGACGCGAGCACCACCAGCAGCAGGAGCGCAACGGCGA
CACACTTTGCCATTGCTAACTGGGAGGTTCTGAACTTTTGATACTAGTGACTAGTGAGGAGCAGTCTAGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
page-top