Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25116  (registered. 2003)
Contig Information
Length 1910 bp
Clones 63 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 7
Wh_EM Dormant seed with water absorption 5
Wh_EMC Dormant seed with cold treatment after water absorption 18
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 11
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1621
Evalue 3.79196e-178
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25116
AGGCTGCAAAATTTGGGGTGCACCGCGGCACTCCTACAAGGAGATGTCATGAATTTATGCGGTCAGTGCCTTTATTTCTAATCGAAGGATGTACACAGAT
ACACCACTGTTCGCCGCTGTAGAAACTTTTACTGCTCCAGTCAAAGTCGTCTGTGATTCTGGTTTCTCATGGAGACCTGAACGCTTCGCCGGCGTACCGC
ACGTTGCCTAGCTCCTCTTCAATCCGCACAAGCTGGTTGTATTTGGCCAGTCTCTCGCTTCTGCAGGGAGCTCCGGTTTTGATCTGCCCGCTCGCTAAAC
CAACGGCTAGATCCGCAATGAAATTGTCTTCTGTTTCACCACTCCTGTGGCTGACCATCACGCCCCAACCAGCAGCCTTTGAATCCAGAGCAGCTTGAAT
AGATTCCGTGACGGTACCAATCTGATTAACCTTGAGCAACAGAGCATTGCAGGCCTTCTTGTCAATAGCCTCTACTATACGTTTTGGGTTTGTGACAAGC
AAATCATCCCCGACAATTTGGATATCAATTTTTTTTTTTCACGGATCCATGGTTTGAAAAACAAGCACAAGTGCCAAATGCTTATTACATCGGATAGCTC
GCCATAGCAGGACACAACGACAGGACAGAAACTAAGCACACACACTCACGGACACATCACCACCGCCGACCGCACACGACTTTTATTCTACCGACACGGC
AACAGATCACAGGCCGATCTCTACCAAACTCCGGGTCACGGTGGCGATCAACTCAGCTTCAGCAGCATGACACGTTTACCAGGGGAGGATCTTCCAGCGC
TGGTTGTCGCCCTCACACCACTTCCACAGCACGAGGGAGGTGCCGTCGCGCACGCCGCCGTGCTCCTTGTCGCCGTGGAGAGCGTCAAAGTTGAGGTAGA
TGTTGTTCACCATGCGGATGCACCGGAAGCCGGCGCCCACGTCGCGGCTCTCAGTCCACAACACTGACTCGTCCTGGTAGTTGGCGTTGTATGGCACCAG
CTTCACCGGGTGGCCCTCGCCTTGGGAGTGCTTGATGGCCTCGCCTGTCACCTTGTTGACGAGGGCGAAGGCCGGGTAGCCTTCCTCATCCTTGATGCGG
TTGCTGTGCCTCATGTCCTTGAACCAGTGCTGGTACTCGTCGCGGGGGTTGGTGGGCGCGAGGACCACAGCGCCGTTGCGAACGGTGGCGCTGAAGCCGT
CGTCGGCCTTGCAGAAGATGCGCACGGTGGGCTCTGTGGAGCCGCCGCGGGGGGCGTTGGCGCTGCCTCCGGCGTAGGCCTCTTCGCCCCAGGGGAGGAT
CTTCCAGCTCTGGTTGTCGCCCTTGGCCCACTCCCAGAGGACGACGGTGGTGCCGTCGTGCACGCCGCCGTGGTCCTTGTCGCCGTTGAGGGCGTCAAAG
TTGAGGCGGATGTTGTTCACCATGCGAATGCAGCGGAAGCCCTTGCCGACGTCGCCGCTCTCCGTCCACATCACGGACTCGTCGAGGTACTCCGGGTTGA
ATGGCACGAGCTTCACCGGGTGGGACTGGCCGAGGGAGTGCTTGACGGCGAGACCAGTGGCCTTGTTGACGATGGCGAAGGCGGGGTTACCTTCCTCGTC
CTTGATCTGGGTGCTGAAGCGCATGTCCTTGAACCAGTGCTGGTGCTCGTCGCGGGGGTTGGAGGGGGCGAGGACGACGTTGCCGTCGCGGACGGAGAGG
CAGTAGCCCTCGTCGGCCTTGCAGAAGATCTTGAAGGTGGGCTGGTTGCCGCCGCCGGCGGCCGGAGCGTTGGCAGGGGGGTTCTGGCCATGGTGGCCGT
GGTGACCGAAGCCGAACATGCTGTGATCTCTCGGGGGTTTGCGGGACAGAAGGAGAAAGGTTCTGGACGGGGCGATGAGAAACTGCGTCCCTTGGGTCCC
NTTTATAGAA
page-top