Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25100  (registered. 2003)
Contig Information
Length 1728 bp
Clones 61 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 6
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 7
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 22
Homology (BLAST) Top Hit RecName: Full=Alanine aminotransferase 2; Short=ALAAT-2; AltName: Full=Glutamic--pyruvic transaminase 2; AltName: Full=Glutamate pyruvate transaminase 2; Short=GPT; AltName: Full=Glutamic--alanine transaminase 2 >gi|469148|emb|CAA81231.1| alanine aminotransferase [Hordeum vulgare subsp. vulgare]
Score 2255
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25100
GAGACGGATAGCTAGAGGCGTCGGAAGATACTCGCTGCTCTGCCGCTGCCGCCCCCTTCGCCTTTAGTTGATCTCGCCATGGCTGCCACCGTCGCCGTGG
ACAACCTCAACCCCAAGGTTTTAAAATGTGAGTATGCTGTGCGTGGAGAGATTGTCATCCATGCTCAGCGCTTGCAGCAACAGCTGCAAACTCAACCAGG
ATCTCTACCTTTTGATGAGATCCTCTATTGTAACATTGGGAACCCACAATCTCTTGGTCAGCAACCAGTTACATTCTTCAGGGAGGTTCTTGCACTTTGT
GATCATCCAGACCTGTTGAAAAAGGAGGAAATCAAAACATTGTTCAGTGCTGATTCTATTTCTCGAGCAAAGCAGATTCTTGCCTTGATACCTGGAAGAG
CAACAGGAGCATACAGTCATAGCCAGGGTATAAAAGGACTTCGTGATGCAATTGCTTCTGGGATCGCTTCACGAGATGGATTCCCTGCTAATGCTGATGA
CATTTTTCTTACAGATGGAGCAAGCCCTGGGGTGCACCTGATGATGCAATTACTGATAAGGAATGAGAAAGATGGCATTCTTGTCCCGATTCCTCAGTAC
CCTTTGTACTCGGCTTCTATAGCTCTTCATGGCGGATCTCTTGTCCCATACTATCTCAATGAATCGACGGGCTGGGGTTTGGAAATCTCTGATGTTAAGA
AGCAACTCGAAGATGCTCGCTCAAGAGGCATTGACGTTAGGGCTTTGGTGGTTATCAATCCAGGAAATCCTACTGGACAGGTACTTGCTGAGGAAAACCA
ATATGACATAGTGAAGTTCTGCAAAAATGAGGGTCTTGTTCTTCTGGCTGACGAGGTATACCAAGAGAACATCTACGCTGACAACAAGAAATTCCACTCT
TTCAAGAAGATAGTGAGATCCTTGGGATACGGCGAGGAGGATCTCCCTCTAGTATCATATCAATCTGTTTCTAAGGGATATTATGGTGAGTGTGGTAAAA
GAGGTGGTTACATGGAGATTACTGGCTTCAGTGCTCCAGTAAGAGAGCAGATCTACAAAATAGCATCAGTGAACCTATGTTCCAATATCACCGGCCAGAT
CCTTGCTAGTCTTGTCATGAACCCACCAAAGGCTAGTGATGAATCATATGCTTCATACAAGGCAGAGAAAGATGGAATCCTTGCATCGTTAGCTCGTCGT
GCGAAGGCATTGGAGGTTGCATTCAGTAAACTTGAGGGAATTACTTGCAACAAGGCTGAAGGAGCAATGTACCTGTTCCCTCAAATCTGTCTGCCACAGA
AGGCGATTGAGGCTGCTAAAGCTGCTAACAAAGCACCTGATGCATTCTATGCTCTTCGTCTCCTTGAGTCGACAGGAATCGTCGTTGTCCCTGGATCTGG
ATTTGGCCAGGTTCCTGGCACATGGCACTTCAGGTGCACGATCCTTCCGCAGGAGGAGAAGATCCCGGCAATCATCTCCCGCTTCACGGTGTTCCATGAG
ACGTTCATGGCAGAGTACCGTGACTAAACTGGTGTAACATGTGTGGGATTACATGCAAGCCTCATGGATTTTCCCTAGGCGTTTTTGCCCGCGTTGACAG
CAGTATCCTGTAGATGAGACAAAATAAAGCAAATCCATGGCTTGTGTGTGTGATACTATATCAGATTACCAGTCTGATGCCTTTGATGGCAAATTGGCAA
CTGAGAATTTTTATTTCCAAAAAAAAAA
page-top