Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25097  (registered. 2003)
Contig Information
Length 1348 bp
Clones 61 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 15
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 12
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit aquaporin [Hordeum vulgare]
Score 1433
Evalue 1.5355e-156
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25097
ACAGGCTAAACAGCAAGCCAGCCCGCTCATCCTCGCTGTCACGCCGGGCCACCACCACCCGCCGTCCTCGTCACCCGTCGTCCTCCACCCCTTCCTTCCA
GAACCGCCGGTTGGCCCTATAAGACTCTTCAGTCCCAGTGCGGCCCTCACCACAAGCTCACAAAAGCCATCTTGTTCCATTCCAGCTCAGGCGAGCAGCG
ACCACCTTCCGGCGAGGGTAGCAGCGATGGAGGGCAAGGAGGAGGACGTGCGGCTCGGAGCGAACAAGTACTCGGAGCGGCAGCCCATCGGCACGGCGGC
GCAGGGGTCCGAGGACAAGGACTACAAGGAGCCCCCGCCGGCGCCGCTGTTCGAGCCCGGCGAGCTCAAGTCCTGGTCCTTCTACCGCGCCGGCATCGCC
GAGTTCATGGCCACCTTCCTCTTCCTCTACGTCACCATCCTCACCGTGATGGGCTACAGCGGCGCCACCTCCAAGTGCGCCACCGTCGGCATCCAGGGCA
TCGCCTGGTCCTTCGGCGGCATGATCTTCGCCCTCGTCTACTGCACCGCCGGCATCTCCGGCGGGCACATCAACCCGGCGGTGACCTTCGGGCTGTTCCT
GGCGAGGAAGCTGTCGCTGACCCGGGCGGTGTTCTACATCATCATGCAGTGCCTGGGCGCCATCTGCGGCGCCGGCGTGGTGAAGGGGTTCCAGCAGGGC
CTGTACATGGGCAACGGCGGCGGCGCCAACGTGGTGGCGCCCGGCTACACCAAGGGCTCCGGCCTCGGCGCCGAGATCATCGGCACCTTTGTCCTCGTCT
ACACCGTCTTCTCCGCCACCGACGCCAAGAGGAACGCCAGGGACTCCCACGTTCCCATCCTCGCCCCGCTGCCCATCGGGTTCGCCGTGTTCCTGGTCCA
CCTGGCCACCATCCCCATCACCGGCACCGGCATCAACCCGGCGAGGAGCCTCGGCGCGGCCATCATCTACAACAGGGAGCACGCCTGGTCAGACCACTGG
ATCTTCTGGGTCGGCCCCTTCATCGGCGCCGCGCTGGCCGCCGTGTACCACCAGGTGGTCATCAGAGCGATCCCGTTCAAGACCAAGTCCTAAGCCGCTC
CTGCTGCTGCAAAGAAGATGCCAGCCCAAACCGAAGAGCAGGCTGCGTGTTCTGAATTTCTGATGGGGCGGCTATCTCTTCCCATCATCATCCGTGTTAC
TACCGTGGAATTCCAATTTGTCTTCCAAGTTTGATGTACTAGTCTTGCTCTGTATTCACCTGAACCTGGACCCAGACTTGTATGTAATCTCATCAGTACT
CAGTTGTGTGTGCAAATCCAATCCAATCAAGTTTATTCAAAAAAAAAA
page-top