Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25092  (registered. 2003)
Contig Information
Length 1029 bp
Clones 61 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHDr Shoot grown with dessication 29
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 8
Wh_VABA Shoot with ABA treatment 6
Wh_VWD Shoot grown with dessication 8
Homology (BLAST) Top Hit putative brown planthopper-induced resistance protein 1 [Oryza sativa Japonica Group] >gi|48716345|dbj|BAD22956.1| putative brown planthopper-induced resistance protein 1 [Oryza sativa Japonica Group] >gi|125541636|gb|EAY88031.1| hypothetical protein OsI_09454 [Oryza sativa Indica Group] >gi|125584159|gb|EAZ25090.1| hypothetical protein OsJ_008573 [Oryza sativa (japonica cultivar-group)] >gi|164375547|gb|ABY52941.1| putative brown planthopper-induced resistance protein 1 [Oryza sativa Japonica Group] >gi|215678986|dbj|BAG96416.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694386|dbj|BAG89379.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215701142|dbj|BAG92566.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737624|dbj|BAG96754.1| unnamed protein product [Oryza sativa Japonica Group]
Score 720
Evalue 4.90597e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25092
ATTTATAGGCATGCCCTTTTTTAAGCATATTGCCTCCATTCCTCTTAAATATTACAATGAGTTTTTGTTTTTCTTGCCGTGGAATCTGGAAGTCATTGCT
CATGGAAACATTTTCGTGTGCAGATACCAAACAGTACAGTACAGAGCAGAAGCTTCCTGGCGTGCTTCTTTACAAGGAAAAGCTCTCCTAAATGCTCCCA
GGCTTATTTTTTGCGATACAGACTGCAAACACTTTTACAGACTATAGGATCTGCCTGCTACTCAAAGTACCGCGGACACACATATTTACAGATCCACAAG
TACCGGGCATGGACTCCTGCATCTCTAAAACTTCAGCATGGCCTCCAACGCGCGAAGAACGTCATCGCGGGTAACTATACCTATTACTTGATTGTCCTGG
TTTACTATCGGTAATCTGTGGATCTTCTTCCTGAGCATCAGAGCTGCGGCATCGGTCACTGTTTTATCGCATGATAGCGTGATTGCTGGAGATGTCATCA
CATCTGCAATCTTCGTCTTTGGCCCATGTGAAGCCCTCACGTGATCGCTCTTGACGACGACCCCGACACATCGGCGGGCACTGTCGACAACCGGGAGGCC
TGACACGAGCTGGAAGTGGCCTTCAACCTCCACCAGCGCCTGCTCCGCTGTGACCATCAGCACGGGCGTCGACATGGCCTCACGCAGGAGAGGCCCCCGC
TGCTGATCGCCGGCATGGGATGGTTGTTGTTGCTGCTGCTGCTGCTGTGACTGGAGGTATGCGCGGAGGTCGTCGTAGCTGAGGAGGGAGAAGTTCTCGG
GCCACTCCCCGGAGATGATGGCATCGGGGTTCTCGTCGAGCCCGAGCCGGAGCCCGCTCCCGTCCATGAACGTGGACGCCCGGCACTCAAAGGTCCCGCC
ACTGGCTCTACCTCTTCTGGCCTTACTCTTGGCCCCTTTGAACATGGAGCAGCTCTGCAAGGTATTGATGCACGCCATGGATGCTAGCTACTCTTCACTG
CTTCCTTGTCTTGTGTTGTGGATGCGGCA
page-top