Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25072  (registered. 2003)
Contig Information
Length 1863 bp
Clones 58 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 6
Wh_VABA Shoot with ABA treatment 15
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit Os03g0439700 [Oryza sativa (japonica cultivar-group)] >gi|108709042|gb|ABF96837.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113548925|dbj|BAF12368.1| Os03g0439700 [Oryza sativa (japonica cultivar-group)]
Score 1016
Evalue 5.2757e-108
Total Hit Count 130
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25072
ATGGGGCAGCCAGTGTATGAAGAAATCTATTACAGAATCAACAACATCGTTCTTCCCAAAATTTCATTCCGATAAGATACATTTGCTTAACTTGTGCTTA
TTATTATATCAATGTGGCAAACTGCATATACCAGAATACGTATCTACTATTACTATTTGTTATCATCAGTTGAGCAGGTCGTCTGAGGTGCAGTACTGAC
CGCCGGCGAGCGCCCGGTAGTAGCGGTCCCTGCAGTAAACCGGGCGTCCATTGGCGGCCTCCGCAGCAGCCGCAGCGAGGTCGTCGTCTTGCCTCACCTC
GGCAGGCAGCTTCAGCAGATCCTCTCTCCTCATCATCGGCTTAGAGGAGGCGGCAGTGGGGGCTCCATTGAAGGAGTGGACGAATTCCTCGACGGGGGCG
GCGAAGGCGAAGAGTGCCACCGCCCCGACGAGCAGCGCACCGGTGCCCACCAGTGTCTGTTTGAGCAGGTTGATCACCGGCTTTACCTTGTAAGATCCCA
ATAACCTGTCGCGAGCCAGCACCTCTGCTGGCTTGACCCACATTTGGCCATCGTACCACCCGGTTTCTTCATACGGCACGACTGCCGACAATAGCCTGTC
ACCAACGTAGCTCCAACCCAGGTAGAGCCTGAGAACCACAAGAGACACCAGGAGCAGGGTCCCAATCCCAGCAGCTAGCACGAACTTGAGTGGATCCTTT
CCGGGACTGAAACTTGCGGCTGAGATTGGGGCCGCCAGAACTGTAAATGTGACCAGGCACAGGCTGCCTAGGCGCATGAAGAAAGAGCCCGGACTCAGCT
CTGCCCACGAGTACAAGGTGCTCTCCTTGAGAGCGGAGTACTCGTTAACCGGTCTTTGCTCGTATGGGACTCCGATCTCCATCCTGGGGTCCCAGCTCGG
ACCGCCCCCGGCGAAGCGGCTTCGGCTGCTCTCCGGCTCCTCCTCCTTGAGCGCCATCGCCACCGCCACGCTCCTCAGCCTCTTTGCCCTCGTGGACGCT
CCACCGCCCTGCGGAAGGGCTCCGGCGAGCCGCCGCGGGGATGCTGTCGCGCCATGGTCATGCCCAAGAAGCAGCGCCACAGGCTGGACGGTGGTAATCT
TCAGGCGGAGCAACATGGAAAAACTCGCGCCTATTATCTTCTAGGAGCAGCAGAGGATAGCTTTTCCCCACGGATCCTTCTCGTCTTCCTCTTGATTCGA
GTCGCCTCTCCCCGTCAGCACAAACATGGACTCAAGCAGGCGCCCAAGTGGAATCCAGCAATTGCTTGCTGCAGAGCAAGAAGCTCAGCAAATTGTAAAT
GCTGCTAGGGCTGCTAAAACGGCGAGGCTTAGGCAAGCCAAAGAAGAGGCTGAGAGAGAAATAGCTGAGTACCGTGCACAAATGGAGGCTGATTTCCAGA
GGAAGCTCACTGAGACCAGCGGTGACTCTGGCGCAAACGTCAAACGCCTTGAGCAAGAGACAACCGTAAAGATTGAGCAGCTCAAGCAGCAGGCAGCAAA
CATCTCTCCAGAGGTGATTCAGATGCTTCTGAGGCACGTCACCACTGTGAAGAACTAAAGGTTGATGAGTCAGCCCTGCATATGATGGCAACTTTGTACT
ATCTGTTCATTTCTTTGGGTGGTATTATAAGAAATGGCTTTTGCCACTTCCAGCTGTAATTCCTTGTTGTCTTGGAAATAAGCTGCTACAGTTCAGCAGC
AGCCATGTCTGATACTACTTGCTAAACCTTTGGTGATTAGTTCGTAAATTTTGTCGATTTCCGACCTTTTTGTCTCTCCCTTGTATGGCTATCAGTATAT
GTATTTTTTTATGTGAGGTATATTATTCATAAGAGTAAATAAGTTTTTAATCCAAAAAAAAAA
page-top