Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig785  (registered. 2012)
Contig Information
Length 780 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125546535|gb|EAY92674.1|| hypothetical protein OsI_14427 [Oryza sativa Indica Group]
Score 316
Evalue 2.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig785
TTTTTTTTTTAAAAATCAATTTACTAATAATTTATTACTCTTCTCAAGCTCAGCTAGGCAAAATAGTTTCAACATGGCATTCACCGTGAAGCGGTACCAA
ATAGACAATAGAACAGGTCATCATTACCCATTACACACCATGATTTCTTCCTCCTTAAGGTGCCACACTTCTCTCCCCTGGCAAAACAATCACCACGCCC
CTAAAATTGCATGCTGCCCCCAGGTTGCTACCGTATCGTTGCGCTTCTACATCATACCCTGGGGCATCCCGGCAGGCGCGGGGGCCTTCTTGCTAGGCTT
CTCCACGACGATCGCCTGGGTGGTCAGGACCATTCCGGCCACCGACGCCGCGTTCTGCAGGGCGCACCTCGTCACCTTCGCGGGGTCGATGACTCCAGCC
TCAACCAGGTTCTCGTGCTTGTCGGTCATCGCGTTGTACCCAAACTCCCACTCGCTGTCCTTGATTTTTTCCACGATCACCTCCCCTTCGACTCCGGCAT
TGTGCGCTATCAATGATGCCGGTGCCACCAGAGCCTTCTGAATGATATCAGCACCGAGGCGCTCCTCAGGGTCATCCAGCTTCTCCTTGATGGCTGGTAC
GAATGTCGACAGGTGAACATAGGCCGCACCACCTCCAGGTACTATACCTTCCTCAATGGCCGCAAAAGTTGCATTCTTGGCATCCTCTATGCGGAGCTTG
CGGTCCTCGAGCTCCGTCTCGGTTGCAGCTCCAACCTTGATCACAGCAACTCCACCAGAGAGCTTTGCTATTCTCTCCGC
page-top