Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25064  (registered. 2003)
Contig Information
Length 1397 bp
Clones 58 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 9
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 9
Wh_VHS Shoot with heat shock treatment 8
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit putative 40S ribosomal protein S3 [Triticum aestivum]
Score 1108
Evalue 7.7714e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25064
AGAATCAATCCAAACAAAGGTTTCAGGCATACATAGCTCGTCTCGGCAAAACTTAGTTTAAACGAAATTAACATAGCAGCATTACACAGAAACTTTTGTC
CATTAAAAAGTAAGATAGGTAACCAAGCGTTGCATAGCCCTCGCTTATCACAGGGATAGAAAACTAGCTAGGACCAAAATGATGTGACGTTTCATGGTCT
GCTTGCTCTATTGGGACTTCAGACCTCAACCAAAGCAGGGGGGCGCAGCTCGTCCTCCTCCTTAGGGGGGTGGATGGTGACGAGGTCAGGCAGCGGGGTG
GTAGGGCCAAGCTTGCCCTTGGGGTCCCAGTCAAGCATAATCTTCACCTTGATACCAAGAACGCCCTGTCTGAGAAGAACGTGCCTAACTGCAGCATCAA
TGTACTCGTTGACGGGCTGACCAGATGAGATCATGTACCCGTCCTTGAACTTCATCGACTTGGCTCTCTGGGCCCTGAGCTTGCCGCTCACAATGACCTC
ACAACCCTTAGCACCACTCTCCATAACAAAGCGAAGAACACCATAGCATGCCCTGCGGACGGCAAGGCCTCCGAGGAGCTTGTAGCGGAGTGACTCAGCC
TGGGCGATGGCGCAGAGGCCACGGTTGACGACCTTCTCGGCGTAAAGCTCAACGCCGTTCTCCGGGAAGTTGAAGCGCTTCTGGACGACGGAGGTGAGCT
CCCTGATCCTGCGGCCCTTCTCACCAAGCACGTTCTGCGTCCGCGTGGCCCTGATGATGATCTCCGTGCGCATCGGCGTCACGCGCACCTCCACGCCGGA
GTAGCCGTCCTCGGCAAGCTCCCGGGTCAGCATCTCGTTCAGCTCGGCGTAGAAAACGCCATCGCTCACAAACTTCTTCTTCTTGCTGATCTGGGTCGCC
ATGGTTGCGGCGGTGGAGGAAGAGCTCGCTGCGTCGGCGGCGAGGCTGTGAGAACGACGGCTAGGGTTTTGTGGGCAGAGGAGAGAAGAGCCTCGTGCCG
AATTCGGCACGAGGGTGGGATTCGACGGGCTGAACAACCCGGAGAAGGTGGCGCAGGACCCGGAGGTGGCGTTCAAGGCGGCGCTCTGGTTCTGGATGAA
CAACGTGAAGCAGGTCCTGCCGCGGGGGTTCGGCGCCACGACCAGGGCCATCAACAGCGGCGAGTGCAACGGCGGGAACGCGGCCGCCATGAACGCCCGG
GCGGGCTACTACAGGGCCTACTGCAGGCAGTTCGGCGTCGACCCGGGGAACAGCCTCACTTGCTAGGTGCTTCGGGCGGGCCTGATCGAGATCGACCATG
CATAGAACAGAGAACACGCATGGCTTATGTAGAATAAACGTCCGGCGTGCGCGTACGCGTCTAAAGCCGTCCAAACAAGAAATAAAGGGCGAGGATG
page-top