Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25063  (registered. 2003)
Contig Information
Length 1644 bp
Clones 58 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 12
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VABA Shoot with ABA treatment 12
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 9
Homology (BLAST) Top Hit Os07g0152900 [Oryza sativa (japonica cultivar-group)] >gi|34395056|dbj|BAC84719.1| putative glycolate oxidase [Oryza sativa Japonica Group] >gi|50508805|dbj|BAD31578.1| putative (S)-2-hydroxy-acid oxidase [Oryza sativa Japonica Group] >gi|113610445|dbj|BAF20823.1| Os07g0152900 [Oryza sativa (japonica cultivar-group)] >gi|215678898|dbj|BAG96328.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692798|dbj|BAG88242.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218199102|gb|EEC81529.1| hypothetical protein OsI_24928 [Oryza sativa Indica Group]
Score 1703
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25063
TCCTTCCTTCCCCTCAGCCTTGAGGGGACAGTCAGCCACAGCCTCCTCATACAAGGTGGTGATTTGCACAGACAAATGGAGATCACCAATGTCACAGAGT
ACCAGGCCATCGCCAAGCAGAAGCTTCCCAAGATGATCTACGACTACTACGCCTCCGGCGCCGAGGACGAGTGGACGCTCCAGGAGAACAGAGAGGCCTT
TGCCAGGATCCTGTTCCGCCCGCGCATTCTCATCGATGTATCCAAAATCGACATGACAACAACTATCCTGGGGTTCAAGCTCTCAATGCCCATCATGATT
TCCCCCACTGCCATGCAGAAGATGGCTCACCCAGATGGAGAGTATGCAACTGCCCGCGCAGCATCAGCAGCAGGCACTATAATGACATTGTCGTCCTGGG
CTACTTCGAGTGTTGAGGAGGTTGCCTCAACCGGACCAGGGATCCGTTTCTTCCAACTCTATGTGTACAAGGACAGGAAGGTGGTCGAGCAGCTTGTGAG
GAGAGCGGAAAAGGCTGGATTCAAGGCGATAGCGCTCACCGTGGACACCCCGCGACTTGGCCGCAGGGAAGCTGATATCAAGAACAGATTTGTTTTGCCA
CCAAATTTGACACTCAAGAACTTTGAAGGTTTGGACCTCGGGAAAATGGACCAGGCTAACGATTCAGGACTAGCTTCATATGTCGCCGGTCAGATCGACC
GCACACTGAGCTGGAAGGATGTGAAGTGGCTGCAGTCCATCACCACGATGCCGATCCTGGTGAAAGGAGTGATCACCGCAGAGGACAGCAGGCTCGCCGT
GGAGAACGGCGCGGCCGGAATCATCGTGTCCAACCACGGCGCCCGGCAGCTGGACTACGTCCCGGCGACCATCAGCGCCCTGGAAGAGGTCGTGAAGGGT
GCTGGCGGGCAGATCCCCGTCTTCCTGGACGGCGGTGTGCGCCGCGGCACCGACGTCTTCAAGGCGCTCGCTCTCGGCGCCGCCGGCGTCTTCATCGGAA
GGCCGGTGGTGTTCTCGCTGGCGGTGGCCGGGGAGGCCGGGGTGAGCAACGTGCTCAAGATGCTGCGCGACGAGTTCGAGCTGACCATGGCGCTCAGCGG
CTGCAACTCGCTGGCCGACATCACCCGCAACCACGTCGTCACCGAGGCCGACAAATTCGGCGTCATGCCGTCCCGCTTGTAACTTGGAACCAAATCAAGT
CGGCACGTGCGTCCACGTCGCCGGCGGCCACATATCTGTGTGTGTGTTCCCAACTTCAAAGTGCTGTGATATGGCATGGATCGATCAAACATGATAAATG
AATTAAATACATATACATTATTCCTCGCAAAAGAAAAAATGAATTAAGTACATTACGTGCAAGGCGAGTTTGCATTTATCCAACGAACAAGTTACTCTAC
CGGCCGCCAACAAGTTGATCTCCAAGAAACTAACTAGTTGAACATGTTGAATATATTGTGTACGTGTATATTGTGTCTTGGGCCCACCTCCTAGTTTATC
TGTATAGTTGAAGTTGTGGCCCTCCTCTGTACATCATATATACGTGCCTGGTGCACCGATCAATGCAATTGTGTTGCACAGCCCAAATTGTTGGAAATAT
GCCCTAGAGGCAATAATAAAATGATTATTATTATAAAAAAAAAA
page-top