Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25057  (registered. 2003)
Contig Information
Length 713 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 10
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit 40S ribosomal protein S26 [Zea mays]
Score 365
Evalue 3.75809e-33
Total Hit Count 297
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25057
TTTTTTTTTTTAACCAAAAGGTTCTCTCTGATATAGATAGCAGCGAAATTGTCAAAACATAAAGACCTGATCACAAATTGTGCTTGACCAACCAACTTTC
AGTACAACCGATTGCAGCAAAAACTAGGTAGAATAGTTCAATATCCAGGGACGAGTAAAACTAGGGCTGGCTCCATATCACGGAAGCATTCCCAAACTAG
ACACGGGGAGCAGGAGCACCAGGAACGGCACCAGCGCCAGCAGGCGCGCCACCAGGTCCACCAGCACGGGGCGGGCCACCCTGTCCAGGCCTCGGGCCAT
CATCCCTGCGCCTGAAACGCTGCGGGGGCTCACGGTTCCTCCTGTTCTCACGCGAGCGGACACGGACAATGTGGGCATGGATGGCACAAGACACACAGTG
GTGCACCTTGGCGTACAGCTTGGGAAGCACATATCCATCATGCACACAAGCCTCCTGCACATCTCTCACAGCAGCCTGCTCCACGATGTTCCTCACCAAG
AAACGCTTGATAGCCTTGTCCTTGGGGCAGCACTTGGCGCAGTTGGAGCAGCGGATGTACTTGACGTGGCCGCGGCCATGCTTGTTGCGCCCGCCGTTCC
TCCGCTTGAACGTCATGGTCGCTTCGCGCCGCTAGGCGGGGGGTGGAGGCGCCCGGGAGAGGGGAGGAGGGAGGCGAGGCTCTAGGGTTGCGGCGGCGGC
TTGGTGGAAGGGT
page-top