Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25050  (registered. 2003)
Contig Information
Length 861 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 15
Wh_EMC Dormant seed with cold treatment after water absorption 10
Wh_EMI Dormant seed with water absorption after breaking 15
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit DEHA2A07084p [Debaryomyces hansenii]
Score 84
Evalue 2.06097
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25050
ATATGGATATACATTTTTTTTTTTTGAACAGAAAGTGGGTCTTGAAGGACCCAGGCTTCATTGGATAAACACGGCAGTACATATTACAACAGGACCAAAA
TAGAAAGGAACATTACATTAAGTCCCTGACTTTTACAAGGAGGACCCCAGACTGAAAGCAAGAAACGCGATCGGGTCCTTGACAGCCGCCGCCCAGATTG
AACCTCGCCGTCGCCGGGGACGAACCACTTGGCACGACGAAATCGCCATGGAAGCATCACCTGCTCGCCATAACCTCCGAGCCGCCACTGGAACTGCCTC
CCATCAGGCACGCAAGCCGGGAGGAATATAGTCAGCCGCCATTCGGCTAGAAGAAACAGGGCACCTACGAAGACCGGCAGCCATCGATGGGCGCCGTCGC
TCCACCAAAGGGACCTCTGCTGATATGCTCGAACTCGACCTATAAACTTCAGGATTCTGCAACTATCCTGCTTCTCATCCACCACCATGGTAGCCTGAGA
AAACAAGCAGTAGCAGTTGGATGCCCTCCAGATCAGGGAACACCACAACACCAGAACGAGCTTATTCAAGGGGATCTTGCCAGATCCGGCGTCTTCCACT
TTCCACCACCATGGTGGCAAGAAAGAAAACGACGGAGGCCACCACCAGACGCCGCTCGAGAGCTCCAGTGGTTTGCATCCCCACGGCATAACGCCAGACC
ACGGCATGAAGCCAAGACAAACTAAAACTACTGCTGCCCTAATATACACAAGGAAGACCCGAGCTCCTCTCCATATCCATCGCCGGCCGGCAGCGCCGTC
GGACGAGGCGTTGGATCGGGCCGGGCAACCCTGGTCGACTCTCAAAAGAGGAACGGTGAAG
page-top