Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25048  (registered. 2003)
Contig Information
Length 1265 bp
Clones 56 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 8
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 12
Wh_SHDr Shoot grown with dessication 11
Wh_V4816 Shoot grown under cold condition for 16days 10
Wh_V483 Shoot grown under cold condition for 3days 13
Homology (BLAST) Top Hit hypothetical protein OsJ_023685 [Oryza sativa (japonica cultivar-group)]
Score 349
Evalue 6.95438e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25048
TTTTTTTTTTGAAACACTTGCAACAGTACTGACCTCCCACTTCGATTGCTTCCGAAGTAGAGTACTTTAAATTTAAGATCACAAACACTGGAGCCGACGA
ATGCCCTAAAGCCCTCGAGCTACGTACACTCGTGACATCACAGGATCAACAATACCAAGTTCCAAAAAAAAAATGAAATCCACAATATTCAATACATACA
AGCTTACACAAAGACATGCTATCTTAACACAGACAGCATCAGTTGCTCGTGCACAGCGACTCGCTCGTCCAAGCCTGGATCCTGCAGCAGAGGCTGTTTG
CTTAAACTACCAGCACGTACACCGCGTAGATGATCCCCGGTATGTACCCCAGTATGGTCAGCAAGAGACAGATCCAGAACTCCACGCCGAGTTTGTAGCG
CAGGAAGACGCCGACGGGAGGCAGGATGATGGCGAGGATCACCTCCAGGACTGTTGCCGAGCCCATGGCTTGCTCACTTCACTCGAGGCCCTCTCCTTTC
TTTCTCTCTGCTTTCCCTTCTGAAAGAGGCGACTGGATATTGATCTCCTTCTCCAGCAAAAGTGAAAATAACACAAAAATCCTCACAGGTTCAACCACAT
AGCTCCCAACATTACATTCCATTCTTGGGACATCAAAACTCTCTTAATGGAGGTAAACAAGGAGAGCCTGCTAACAGTTACTAAAGCAAGATGGATAGAA
CATTCCCGCTACTAGAAAAGGCATTGTCTGGCTTGATGCTTAAACCTCCTGGACGCTCAAACCTGGTGGGAGGGACTGCTTGAGCTTGTTGGCCTTGTCG
GCGTCGAAGACGCAGAGCGTGTAGAGGTACCTGGAGCAGCGCACCTTGAACTTGACGGCGTCCTTGGTCCTCTTGATCCGCACCGACCGCGCGTCCTTCC
GGCGCGCCGTCAGCAGGAAGTCCTTGATCTCGTGGATCTGCTTCGGCATGGTGGACGACTGTGCGCACCCGAGGAGAACTCTCCCTTCCTTGAGAAGCTG
AAGAAGAAGGGCTATGAGGTCATCTACATGGTTGACGCCATTGATGAGTATGCCATTGGTCAGCTCAAGGAGTTTGAGGGGAAGAAGCTTGTCTCTGCCA
CCAAGGAGGGTCTGAAGCTTGATGAGAGCGAGGACGANAAGAAGAAGCAGGAGGAGCTCAAGGAGAAGTTCGAGGGTCTGTGCAAGGTCATCAAGGAGGT
GCTGGGTGACAAGGTGGANAAGGTCATCNTCTCTGACCGNGTTGTGGACTCTCCTTGCTGTCTGG
page-top