Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25047  (registered. 2003)
Contig Information
Length 1585 bp
Clones 56 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 4
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 6
Wh_VSCB Liquid cultured tissue 9
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit aspartic proteinase [Triticum aestivum]
Score 2201
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25047
TTTTTTTTTTGACAAGCCGGCTAAGCTTCTGGCGTGATAAACCACAGGTTACTAGTAGAAGGTAAACGTTGTTTATCACATACTAATTCAACAACATTGT
CGGAACAAACATCCAGAAACAGTCTCAGCCATCTTAGGAACCACCCTTAGTCATGTCAGGGTCTTTTGAAAAGCAGCATGTAGCATATATACACACACAT
CACCGGTCAAATTCAGAGTAAAAAAGCTAAGCTCTTTCCCGGCGCAAGTGTTCGCCTCCACGATGGGGCGCTCGCTCGATCACCCCTTCAGGCCGCCTTG
GCGAAGCCGACCCGCAGCTTGCCGTAGTCGAAGACGGTGTGGTAGGGGCCCATGAAGACGTCTCCCAGGATCCAGAGAGGACCACGGGGAGGGGGGATGT
CCATGGCTGTGAATCCACTGATGCACTGGGCAGCGGCTCCTTCACCGACCTTCAGGATATACTCTTCTGGTTTCAGCGCAAACTTCTTGCCACCAATGGT
GAACTCAATGTCAGGCATGGATCCAAGGCTCGCACAGTCCACGGCTGACTCTCCCATGGGACTTGGGAGACGGTTGCACAGCTGGTTAACGTAATCTAGT
ATGAGATCCTGGGTCTTGTTCTGTGCAAGTTGGTTCTGCATCCACACAACAGCCATCTCACAGGCACTGCACATGGGATCGGTACGGAGGCCATTCGATT
TCACAGGCTCATCATCGACCACGCTCCGAATTCCAGCACTAACACCACGAGTCCCATCAAAGGTGCACAGACCAACCTGGGAGCAGACCTTTTTGGGCTG
TGTCTCTGCTAGCAACAGGTCGAGGATCTGTTGTCCATACTGAGAAACAATTGTTTTGCACTCTTGGCTGACTACCCCAGCAGCACCAATCTTCTCGTTA
ATTTCAGTAATGATGGCCGTGGGGCCAGCAAGCAGTGAAGTTCCAGAATCAGCAATTGCAGCACAACCGCCAGCACAGAATCCTGTGGACTTCCCTCCAA
CCAGGACATCACCCATGTCAAACTGCCAATATCCCTTCTGGGTGACTGGGACATATGTGTGTTCACCCACGTAGTGTTTAGGATCCATTCCTCCAAAAAT
AATTTCACCACCCTCTCCTTCATCATCAGCATGTCGGTTCAACCAGAATGAGAAAACAGGATCACTGATCAGACCTTGCTCTACCATATTATACCACACA
GGTACTGCTTTGCCAACAGATATTTCCTTAAACCCAAGCCCAAGAATACCATCGAACTTTGCAACCAAGAAAGTAACACCTGGCTCCTTTGTAGCTTCAA
TGAACTCCTGATCTTTCACAACTAGATCACCCACTGTAACACTATCCTCACTGAAATATCCAGCAATTGAACCAGTGCCGTACTGAATGGCAGCAGGCTT
TCCATTCTTCTTGTAGGTGCTGGACGCCCCGGCCTTGTAGCGTGCGTGGAGGTAGCACGCAATCGAGAAGTAGCACTTGGCGGAGGGCACCCAGAGGTTG
GAGCTGCCGGTGTCGAAGATGACGGTGAACTTCTGGGGCGGCGTGCCGACGCCGATCTCCCCGAAGTACTGCGCGTTCATGTAGT
page-top