Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25035  (registered. 2003)
Contig Information
Length 844 bp
Clones 55 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 10
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 9
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit ribosomal protein L13a [Triticum aestivum]
Score 988
Evalue 2.98437e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25035
CACATTTGATAAACGAAACAGTTCACCATGTAGAAAATTTCAAATGAGTGTCGCAGAACTGCATGCATAACAAAGGTTTACCAACCAGATTGTACTATCA
GAGTTACCAAACTACTTAAAATACGACAGAGGTTTCCCAAAACTGATGGCGCACGAAAGCTCTGATATCTCTTAGTATTTGATAGGGGCCAGGATCTCCA
GCTGAGTTCCCAACTTCTCCTCGGCTGCCTTCTCGGCCTTGACGCGGAGCTTCGCCAGTTGCTTTCTCCTGTCGTAGGAGATCTTGGCCTTCTCCTTCCT
CTTTTCCTCCAGCTCCCTGATGGTGTCGGCGTAGTTCCATCCGACCTCCTTGGAGAGCTGGCCGAGGAGGCAGTACCTGTGCCCAGGCTGCAGCCTCAGA
ACCTTGAGCGCGTCGGGGATGACCATGCGCTTGGTCCTGTCGTACGGCGGCGGCACGCCCTCGTACGCCTTGAGCCTGGCGAGCGCGGCCTCGCCCCTCG
CGGTCTTGTGCGGAATCATACCGCGGATGGTGCGCCAGAGGATCTTGGCCGGGGCGCGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATCCTCTT
GCGGAGGAAGCGGAGGTACTTCATCTTCTGGCGGACGAGGCCGCCGGACATGCAGATCTCCTCGCATCGGACCACCACCACGCGCTGCCCGTTGAGCAGC
TCCTTGGCGACGATCGAGGCCAGGCGGCCGAGCATGTGGTGGCGGGCGTCCACCACCACTCGCTTGGCGCACACGCCGGAGCCGGACACCATCTCGCCTC
TTACCTGGCGGCGGCGGCGCTACTAGGGTTTGGAGTTCGGGGGG
page-top