Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25031  (registered. 2003)
Contig Information
Length 1947 bp
Clones 55 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 12
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 10
Wh_SHDr Shoot grown with dessication 6
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit reversibly glycosylated polypeptide [Triticum aestivum]
Score 1938
Evalue 0
Total Hit Count 421
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25031
ACCAGGGGCTGAATTACATATCAAAACATTGTCTTGCCAGTGTTTCACAACTCAGCTAAATAAAGGCTAAAACATCATTGACTCTAGTTTCCTGGCCAAG
GATAGATACTTCAGACACAAGGTGCCCCACAACTTAGTCGAACAGACTGAAGCCCATGTCATCATCACTCTCTTCCTTCTCCACGACCTTCTCTTCTTTC
TTTGACTCAGCTGCAGGGGCAGCAGCACCTCCAGCAGCAGGGGCAGCAGCTGAAACAGCCACACCACCACCACCAGATGGAACCGCAGCAAACTTCTCCC
TACCAGCAGCCAAGAGCTCGGTGATGTCCTTGCCCTTCACTTGGGACAGCATGAGTTCCATCTTCTCATTGTCGATTTCACAACCAACAGACTCAAGAAT
GGATGTCAGGTCCTCTGCAGAGGGGCTGGCGTTGCCAGAGAGGTAAGCAAGCAGATAGGCAGCAATGAACTTCATCTTGGATCGGAGAAGGAAGGAGAGA
GCTGAAGGCGGGGCGGCGGCGGAGGGCTCGACCGATCTGCTAGGGTTTCTGCCTCGTGCCGAATTCGGCACGAGGTTTTTTTTGATTTCTCAAAATTACA
TGATAAATATTATTGTCTTGAATTATGTAAATGATAACAAATCCTTGCTCCAGCTACAAAAGAACCACCAGCATAACATGAAAGAAATATAAAAGCTGCT
TCAGTAATCTCTTTCTCAAAAAGAGCTATATCTAGGCCCCAACCATACATTCTTGGCTCCCCAGCCAGCCTACATGGCTGCTGCCTTGCCGTTCCCAGCA
GCAACGACGGTATCAGATGGGTTCAGCTCGTCCCAGGCCTCGATCCAGGTGACCATGGCATCAGCAAGCTTCACGAAGTAAGGGTCAATCTTGCCAAGCT
TCTCCTTGACCTGCTCCGAGAGTGAGATGTAGCACTTCTGGACTGTGTCACACTCCTTGGAGAGGGTGGCGTTCTGGAAGAAGGGGATGATGTCCTCCTG
CCAGAAGATGCCCTTGTACTCTTTCTTCAAGTTGACAAATGGGTTGCTAGCCTTGCTGTGCCACAGGTATGGCAGCCCAGTCTTCACTCCAAGGCTCAAG
TGGTCGCAGATGACCTTGACGCACCATCCAGCCCACATGTCATCGTAGCGACCAATAGGCTGGCCATCACCCATGAGGCCAAAGTACATTGCAGGGCCAA
TGAGCTGACGGTCAAAGGCAAGGTTCATGCCACACATGGGGAACAGTGTCCCCTTGGGAATAGTCAGGACGGCATCAACATACCTGCTGTTCCTCTCACG
AGGCTTAACCATCTGTGTGGGTGCATCATAGTCAGGGATGTTCAGCCAAAGGCCATGAGAGACCGCGGTGGGGGCACCCTCCCTAAGGCTGAAGGGGTAT
CCACGGACAAAGTCCGCACCTTCACGGTAGGGGTCATACAAGGTGTTGAAGAAAAACGGGGTGGACGGGCTGAGGAGGTTCTTGATGTGCTGCTCAAGAG
CATTGATGTCTTTGCCAGATGGGTCCTTGGCCACGAAGCAGTCGTCATCGATGGTGAAGACGTACTTCTTCTTGGAGACCATGTAGCCGAAGCAGCGGCA
CGCGGAGTCCTTGAAGGAGATGCATGAGGCCTTGGGGCCGAGAATGCGGTTGATGTCGTTGCGGTTGTAGAGCTCGTAGTCGAAGCCCTCAGGAACCTTG
ATGACCTTGCTGGGGTCGCCGTCCTGCACGATGATGAGGTGGTACGGCTGGAAGAAGGGGCGCCACATCTCGAGGAAGTCGAGATTGCGGATGGTCGGGA
TCACGATGTCCAGCTCGTCCTTGAGCAGCGGCGTTGATGGCACCGACGATCCGGGCACAGTCACCGTCCCTGCCATTGCTGCCTGGCCGGGATCTCGATC
TCGAGCCCTGGATCTCGCTGTTCCTGGAGGTGGTGGTAGGGGTGGGA
page-top