Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25027  (registered. 2003)
Contig Information
Length 1104 bp
Clones 54 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_EM Dormant seed with water absorption 5
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 7
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1031
Evalue 3.03612e-112
Total Hit Count 489
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25027
ACAAACAACACAGCATAAGTTCTATTCAAACATAAAAACACACCGGCAGGAATAAACTAAATATTTAGTTTCAACTCATAACCTCCATCCAGAAAAGTAA
CACGAACAAAATAAGATAGCTGAACGCTGGCTAGGAATGTCGACACAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGG
TGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCGACTTCTATTCTCTACTCAGCAGCAGCAACCTCCTCCGCACCAGGAATGACCTCGTCC
CCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGTAGTCACCGTGAACCTCCATGAGCTTCCCCAGGTCGAACTTGGGGGCCTTCAGGATCT
TCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCTTGAGGTGGCCTTCTCAATCTCCTTTCCGATCACCTCAGGGATGAACTTGTTCACAAGCTC
CTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACC
TGGTTCGGGCGTCTCTTGGTGAAGCCAATGGCGAACATGCGAAGCATGTAGTTGTCAGTTGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACT
TCCTCACAAGGGACCTGAGCTTGTCAGTGGTGAAGTCCATGCCCCAGAAGTTGGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTT
CCTGTAGGCCTGGTCCTCGTCGTTCTGAAGATCAGCTAGAGATACTTCAAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGTGTCCTG
GACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGGCGCCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTCTTG
CTACCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTTGAGCGT
CGGG
page-top