Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25025  (registered. 2003)
Contig Information
Length 833 bp
Clones 54 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 18
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 8
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 5
Homology (BLAST) Top Hit hypothetical protein OsI_33098 [Oryza sativa Indica Group]
Score 256
Evalue 2.20396e-20
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25025
GTTGATGAATAAATCAGAAGTTTTCCTTAAAAAAAACTTATAAACAACCGAAATCCTGCAAGCAGGAAGGGGAACCAGCTAGCTAGCACAACTTTTCGTC
AACAAAAAAAGGGTAGCTAGCACAACTGGATTATTGATCATCAATACAGACAGACATGACTTAAGAAACTTTACAGAACCAGATATCAGCAGCTAACATA
ATTAAGCACAACCACAACGTTATAGAGTAACAAAATACAGAAGTAACGCAGCGCACAAACTTAACAAGAGCTACATGCATGTAGATGTAGAAACCAGACT
TCTACTTCATGAACCCCTGAGCCATCTTCATGAACCCGCCGCCGCCGCCGCTCTCCTTCTCCTCCTCGCCACTCTTCTTCCCCGACAGCGATGCAGCCCC
CTTCATGACGTCGTCGAGACCGAACCCATCGGACGATTTCTCTTCCTCCGCGGCAGGGGCAGGCGCAGGCGCTGCCTCCTTGGGTGCATCCGGCTTCGGT
GCGTCAGCGGCAGCAGGTGCGTCGGTTTTCTCCTTCTCGGTGCCGCCGGAGCTGTACTGTTTCAGGTACCCCTCAGCCTTCTCGAGGTACTGCCCCACCG
GCTTGTCCTCCAGCTTGCCGTACTTGGCGGCGGAGTCGAGGATGTCGGCGGAGGCGGCGGCTACCTTTTCCTTGTCGATGCCCTCGACGCTCTTCTTCTC
GTAGGCCGTCTTGGCGGCCTCCGCGACCAGCTTGCTGCTGGACATCAGGTCCCCGGACGAGTTCTTCTCACCCTCCATTGGAGCTTAGGTGCTGGTAGCA
AAAATCTTTTGTGGCTTAAGAGTAGTGAGGTTA
page-top