Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25024  (registered. 2003)
Contig Information
Length 1743 bp
Clones 54 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 9
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Tubulin alpha-3 chain >gi|4165488|emb|CAA10663.1| alpha-tubulin 3 [Hordeum vulgare subsp. vulgare] >gi|90289602|gb|ABD92933.1| alpha tubulin-3B [Triticum aestivum] >gi|90289604|gb|ABD92934.1| alpha tubulin-3A [Triticum aestivum] >gi|90289606|gb|ABD92935.1| alpha tubulin-3D [Triticum aestivum]
Score 2173
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25024
TTTTTTTTTTAGGCAAACGAGATAACATGCATATTGACCAAGGTGCGAAGCAGGTTCAAACATACCACAGGTTCATACAACACAACAGGTTGTAAACCAA
ACACCACACAGCAAACATTCAAACAGGCAGACAACAGATAAAGCCGCTTGGGCAGATCACAGGATAGTAGTAGACGAAGGCACGCTTGACGTACATCAGG
TCGCAAACTCATCTGCTCTAGTACTCATCACCCTCATCACCGTCCTCGCCCTCGTCGAACTCAGCGCCAACTTCTTCATAGTCCTTCTCCAGGGCAGCAA
GATCCTCACGGGCCTCAGAGAACTCACCCTCCTCCATGCCCTCACCCACGTACCAGTGGACGAAGGCACGCTTAGCGTACATCAGGTCGAACTTGTGGTC
GATGCGGGAGAAGACCTCGACAACGCTGGTGGAGTTGGAGATCATGCACACGGCCCTCTGGACCTTGGCGAGGTCGCCGCCTGGGACGACGCTGGGTGGC
TGGTAGTTGATACCACACTTGAAACCAGTGGGGCACCAGTCCACAAACTGGATGGTGCGCTTCGTCTTGATGGTGGCCACAGCAGCGTTGACATCCTTGG
GCACAACATCACCACGGTACATGAGGCAGCAGGCCATGTACTTGCCGTGGCGGGGGTCACACTTGGCCATCATGGAGGAAGGCTCGAAGGCGCTGTTGGT
GATCTCAGCGACAGAGAGCTGCTCATGGTAAGCCTTCTCAGCTGAGATCACTGGGGCGTAGGAGGAAAGCATGAAGTGGATCCTCGGGTAGGGCACCAGG
TTGGTCTGAAACTCATTCACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCAGTCAGGGATGAGATGACCTGAGAAACGAGCCTATTGAGGTTGG
TGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCATTGTCAAGGAGGACAGCCACATCAGTGTGCTCAAGGAGAGAGTG
GGTGGACAGGACACTGTTGTATGGCTCAACAACAGAGGTGGAGACCTGAGGGGATGGGTACACTGTGAACCCAAGCTTGGACTTCTTTCCATAGTCAACA
GAGAGACGCTCAAGGAGAAGAGAACCAAGGCCAGAGCCAGTTCCACCTCCAACAGCGTTGAAGACAAGGAACCCCTGGAGACCAGTGCAGTTGTCTGCAA
GCTTCCTGATACGGTCAAGGCATAGGTCAACAATCTCCTTGCCAATGGTGTAGTGACCACGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATAAG
CTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCTCACCTCATCAATCACAGTGGGCTCAAGATCAACAAAGACCGCGCGGGGGACATGCTTCCCA
GCACCAGTCTCACTGAAGAAGGTGTTGAAAGCATCATCACCTCCCCCAACGGTCTTGTCACCGGGCATCTGTCCATCAGGCTGAATGCCATGCTCGAGGC
AGTAGAGCTCCCAGCACGCGTTCCCGACCTGGATACCGGCCTGGCCGATGTGGATCGAGATGCACTCCCTCATGGCGGCGGGTCGGAGCGGCGGAAGCCG
GCGCTACGCTGCGCTGGTGGAGAGATCGGGGGAGGAGGGGAGGACGGAGGCCAAAGCTCGGAAGCGCGAGAGAGAGGCGAGTACGAAGACGCCGGTCTCT
GCGATGCTCTGCTTAGGGTTTCCGCTGCCCACACTCGGCTCGT
page-top