Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24992  (registered. 2003)
Contig Information
Length 1820 bp
Clones 51 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit Os01g0276100 [Oryza sativa (japonica cultivar-group)] >gi|6539562|dbj|BAA88179.1| putative isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|81686717|dbj|BAE48299.1| NAD-dependent isocitrate dehydrogenase a [Oryza sativa Japonica Group] >gi|113532256|dbj|BAF04639.1| Os01g0276100 [Oryza sativa (japonica cultivar-group)] >gi|125569901|gb|EAZ11416.1| hypothetical protein OsJ_001241 [Oryza sativa (japonica cultivar-group)] >gi|215765348|dbj|BAG87045.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1793
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24992
CGGTCTGTGCAGTTGGCACCCTTTTTGCTCCCTTTCCCATCCCCATCTTTCGTCCACCCCTCCCCCCTCTCGCCGCGGACCCCATCCGCCGCCCGCCGCC
GCCGCCGTTGACACTACCCGCGAATCTCCTTCTTCCGAGTGGTGGAGAGGAGACATGGCACTCCGGAGGCTGCTTCAGGGGATTGTCCTACCGCGGACGA
CGGGCCGGCATGTTGGGGCATCGTTTTCCACGGAGGCTGGGGAGACTATCCGCGCAACCCTGTTTCCTGGTGATGGCATCGGGCCTGAGATCGCCGAGTC
GGTCAAGCAGGTATTCAATGTTGCAGGTGTACCGATAGAATGGGAAGAACATTATGTTGGTACGGAAGTTGATCCCAGAACAGAGAGCTTTTTGACATGG
GAGAGCCTGGAGTCGGTGCGTAGAAACAAAGTTGGCTTGAAAGGTCCTATGGCTACACCTATTGGAAAAGGCCACCGTTCTTTGAATCTTACATTAAGGA
AAGAACTTGGACTCTACGCCAATGTCAGACCTTGCAACAGCCTCCCAGGCTACAAGACTAGATATGATGATGTGAACCTTGTGACAATCCGTGAAAATAC
TGAAGGAGAGTATAGTGGCCTTGAGCATCAGGTTGTGAGGGGTGTTGTGGAAAGTTTGAAAATTATTACCCGCCAAGCAAGTTTGAGAGTGGCAGAGTAT
GCTTTCCATTATGCCAAAGCCAATGGCAGGGAGAGGGTCTCTGCGATACATAAAGCTAATATCATGAGGAAAACAGATGGACTTTTCCTCAAGTGTTGCC
GTGAAGTAGCTGAGAAGTACCCTGAAATCACATATGAGGAAGTCATTATTGACAATTGCTGCATGACACTCGTGAAGAATCCTGGTACATTTGATGTATT
AGTGATGCCAAATCTGTATGGTGACATTATTAGTGATCTATGTGCTGGTTTGATTGGAGGCTTGGGCTTAACTCCCAGCTGCAACATTGGTGAAGGTGGC
ATTTGTCTGGCAGAGGCTGTTCATGGTTCTGCACCTGATATCTCTGGCAAGAACCTTGCAAACCCAACTGCTCTTATGTTGAGTGCTGTTATGATGTTGC
GCCACTTGCAATTCAATGACCAAGCAGACCGGATCCACAATGCCATCCTCCAGACAATTGCCGAGGGGAAGTACAGAACCGCTGATCTTGGTGGGAAGTC
ATCAACATCAGACTACACAAAAGCAGTTTGCGATCATATCTGAGCACCAGCTGCTCTTTCTGTCGATTATTTGTCTCCCACCTAATTTTGTTGCATACCA
GGAGCTTTAGCCTGAGTAGGTGAAGTGGCAGGCACCTCGATTTCCTTGGGTGTTAAGACACCGTTTAAGGCTCCTGAATAATCCTCGCATTCTTGTCCTT
GGAAAAGTTTTACCAGCATTGCAGTCAAGCTGAAGAATCGTCTGTAATAATCATTGGCAGCATCAGCGCATATAATTTGTTTGTTCTAGTTCTTAGAGAA
CTGGATTTTGATCTTCTTTCTTTTGCTTTTTGTCATGGTATTACCGTCCTCGTTGTGCTCAACAAGGATGCATGCTTGCCATGTACTGGTACTTGACCAC
CTTGTCATCCTTGTTGACAAGCTTTAATTGGGCTACATCGTTAACACATAAAACACTATTGGGGTTCGGAGATTTGAGGGTCTGTGGACACTGATGTTGG
AGGTCGTCATCCAATGCTATCATGTATATGTCCGAATGTATAGGGTTGGAGGTCGTCATCCAATGCTATCATGTATATGTCCGAATGTATTCCGAATGTA
TAGGGTAATTGAAATTCAAA
page-top