Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24991  (registered. 2003)
Contig Information
Length 924 bp
Clones 51 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 17
Wh_EM Dormant seed with water absorption 10
Wh_EMI Dormant seed with water absorption after breaking 12
Wh_KMP Shoot grown under continuous light 4
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 6
Homology (BLAST) Top Hit HNH endonuclease [Acidothermus cellulolyticus 11B] >gi|117649621|gb|ABK53723.1| HNH endonuclease [Acidothermus cellulolyticus 11B]
Score 93
Evalue 0.210989
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24991
TTTTTTTTTTAGCGTAGACCAAGTATCCATTTTTTATTATTATTTTTGAACACAAGAAGGGCCCCGAAGGACCCAGACTTATACTAGATAAGCATGCAAC
ATATTACAGAAAGGCCCAACAGAAAGAGAAAATTACAACCCAGGCCGGACATTTTGCAGATAGGACCCCAGACAACAAAAATGAAAAGCAATCGAGTCCT
CTTCGCCGTCTTCGATCCTGGCCCGATCCCACCACCACCGGGGACGAAACCACTTGGGGTGAAGGAATGGCTACAACACCGCCGGCAAACAACCGGAGGT
AGACCATGGAAATACCAGGACAAAGAACCAGATAAACTGCCTCCCATATGGCTCGGCGGCCAGGAGGAAATACAGGAGCCGGACGTCGTCGCCAGAACTC
CGAGTGGTCGCCTTTCGACCAGCAGATACAGCGGTGCAGTGGCAAGAAACTCCTGGTGCTCTCTGCACCAAGATCCCCAACCATTTGCTGCAGAACTTGG
GCTCCAAGGACACGCAGAGAGGATAGAGCAGCCAAATCCCCTTTCTTCCTCTTCTTCCAATCCACCTCCATGGCAGCTCGAGGAGAAGTAAGGAAGAAGG
AGCTTGAGCTCCAGATCTGAGAGACCCGCGAGCTTATTGAGAGGGATTTCGCCAGATCCAGCGCCTCCTCCCTTCCTCCACCATGGAGACGAAGAAGAAG
ACAAGAACGGCAACCACCGGCAGCTGCTCGCAAGCACCGGCGGTAGAAACCCCAACGGCATAGCGCCAAACCACAAGACGACCTGAACTAAACCAGTATA
TACAAGCATCTCCCGGGTGCCTCTCCCAAGCCATCGTCGATCGGCATCGCCGACGGACGAAGCTCGAGATCGGGCCGGGGTGCCTGGAGCGACTCTCAAA
GGGACGGGTGGAGAAGGAGAGACG
page-top