Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24960  (registered. 2003)
Contig Information
Length 1457 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 5
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 18
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 10
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit hypothetical protein OsJ_023051 [Oryza sativa (japonica cultivar-group)]
Score 124
Evalue 0.000104155
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24960
CCTGATTCAGAATCTCTTCCTCTGTTTTCTTTGTTGGGATTGATGTAATCAAGAAGATCAGATACACTTAGGTGTCCTTTCAAATCCTGACTCCGCCCAT
GATGTATTCCCACATTAATCTCATTACACAACACGCACATAGATGAGATATTCAGCAACACGCATGATCACTGGTGAGCTGATGAATTAGCTCTGTACCC
AGCTTAGCTAGAGCTGATGAATTAGTTCTTCATCTATAGAGTAACCTTATACAATAATCTATATATACTCATAATGGCTTTGTGCTATATATATGACAAG
CTCTGTTTCAAATATGTGCGCATAGACGTCATGGTGTATAACCATCAGTTGTTGCTAGTGTTGGTCGACACAGATACAGTGGCCGACGACGGGCACGGTG
GCTTCGGCTTCGACTTTGCCTTCGGTTTCGAGTTAGTCTTCGACGGACACGGTAGCCTTGGCTTCCGTGCATTAGGATGGCACGGCCGCTTTAGCAGCGG
CTTCGGCGGGGTTGGTTTCGGCGGCATGGGCGACGGCGGCGATATGGGCGACGGTGGCGGCATGGGCTTCGGTGGAGCGGGCTTTGGAGGTGTGGGCTTT
GGTGGCGTCGGCTTTGGCTCCGGCTTTGGTGGCTTCGGACTCGGGGGCTTTGGACCCGGGCTTGGGTGGTGGTGGTGATGGTGATGGTGGTGGTGGTGGT
GGTGGTCCAAGCATTTGTGCCCCGCATGATTTGTAGCAATCCGCCCTGTTTATAGGGTGGGTGATTGAGGCAGGTCTCCGAGATGCACATCTTGTAGCAC
ACCGGCGGCAGGCTCCTGTAGCAGTCCACGATGCACATCTTCTTGCATTTGAAGTACTTCCGCCAGTCGCTGCGGCTGTCGTCGTGGTCGTCGTCGTCGT
CGTCATCGTTATCATCATTCTCATCATCGTCGTCCTTATCATCGTCGTTGTCGTCGTCGTCCTTGTTGTCCTTATCATCATCGTCGTCATCCTTGTCATC
CTTATCATCGTCGTCCTTGTCATTCTTATCACCGTAGTCATCGTCATCCTTTTTGTCGCCCTTGTCATCGTCGTCCCTGTCGTCGTAGCCGTCGGCGATA
TGGGCGACTGCACCATCGGTTTTGTCGACAGCGGCTAGAGTGCCATCGGTGGAGTGTGTGATTGCTGCAGTGCCATCGATAGAGTTGACGGGGATGGAGG
CGGCTGCTGCACCATCGTCGACGGTTGTGTGGACGGCGGGCTGAGTACGATTGACGGAGCGGGCGGCGGCATCACGGTAGCCGTCGCACTTGTGCATGCA
GGAAGAGTAGTACCGCCAGCAATGTGCTCCCTTTGCGGGTTGGGGATCCGCTGCCCCCGCCGCGGCGAAGAGCGCCGCCACGGTCAAGACGGCGGCGATC
CTGGCCACCGCCATGGAGGCCATGCTTCTCCGGTGAAATTTGTGGAGATGGAGATCG
page-top