Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24958  (registered. 2003)
Contig Information
Length 869 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_MS Seed DPA5 of DT3DL CS wheat 10
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|33146750|dbj|BAC79661.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|50508298|dbj|BAD30107.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|113611543|dbj|BAF21921.1| Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|215768067|dbj|BAH00296.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195559|gb|EEC77986.1| hypothetical protein OsI_17372 [Oryza sativa Indica Group]
Score 731
Evalue 1.96659e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24958
TTTTTTTTTTGAGACGGTAAAAAATATATAATATATGGACATTCAGAATAGGAACAAGACAACAATGCTCCGGTAAAGATCATATCGCATCTGGGCAAAA
CAAATTCAGCACCAAAGAAAAAACTGACCGTACAATTTTAAGCAAAACTATTAATGATAGATAGATTCCACAAGACATGTTCAGATCACGACATTCTTCG
GTTTGACAGAAAACACAGGAATCAAATCGCAAAACAGCAGCAGCCTGGTAGGTTTAAGTGCTTAAAACGTCTGACTATGAACTACTCATGAATCAGAGCC
TGGGCTTAAGCAGCGATGAAAGCCTTCTTCCCGCCTCCGGTGGTTCCAGCTGGAACAACCTTCAGGACATTGAATCTCACGGTTTTCGACAGGGGCCTGC
ACTGGCCAATGATGACATGGTCGCCTTCCTTGACTCGGAAGCAGGGGGAGATGTGAGCTGGGATGTTGGAGTGCCTCTTCTCATACCTCTGATACTTCTT
CACAAAATGAAGGTAGTTCCTGCGAACAATGATGGTCCTGTTCATCTTGGCACTGTGGCAGGTTCCAGCTATGATTCTGCCCCTGATGGCAACAGTTCCA
GTGAATGGGCACTTCTTGTCAATGTAGGTACCATCGATCGCTTCCCTTGGGGTCTTGAAACCAAGGCCAACACTCTTCCAGAAGCGGTTGCCAGCCTTGC
CTGGCCTCTTGGCCTTGTCGGCCTTTTTCGTGCTGAGGAAAACCTTTGGCTGCTTGAGGAAAGACTTCTCGGTCTGCTCCGCCATGGCTGCGAGGTGGGC
GTCGAGGGGCTCGGAGGCGGCGGCGGCGGCGCGTCGAGGGGAAGCGGGAGCAAGGCTCTGAGAGGAGTG
page-top