Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24952  (registered. 2003)
Contig Information
Length 1773 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 10
Wh_VABA Shoot with ABA treatment 8
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit polyubiquitin [Zea mays] >gi|248339|gb|AAB21994.1| polyubiquitin [Zea mays] >gi|33323474|gb|AAQ07454.1| ubiquitin [Musa acuminata] >gi|52076878|dbj|BAD45891.1| polyubiquitin [Oryza sativa Japonica Group] >gi|218198760|gb|EEC81187.1| hypothetical protein OsI_24193 [Oryza sativa Indica Group]
Score 1079
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24952
GAACGGAACCAACAAATCCCCAAGCCAATCTCGTCTCCGATCGACTCCAGCTCCCCTTCCTCCGGTCCTCCCCGCCGCCCCAAGATGCAGATCTTTGTCA
AGACCCTCACTGGCAAGACCATCACCCTTGAGGTCGAGTCGTCTGATACCATCGACAATGTCAAGGCTAAGATCCAGGACAAGGAGGGCATCCCCCCGGA
CCAGCAGCGCCTCATCTTTGCTGGCAAGCAGCTGGAGGACGGCAGGACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTTGTCCTCCGT
CTTCGTGGAGGCATGCAGATCTTTGTGAAGACCCTCACTGGCAAGACCATTACGCTTGAGGTGGAGTCATCCGACACCATCGACAATGTGAAGGCAAAGA
TCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCGCCTCATCTTTGCTGGCAAGCAGCTGGAGGACGGCAGGACCCTTGCTGACTACAACATCCAGAA
GGAGTCCACCCTCCACCTTGTCCTCCGTCTTCGTGGAGGCATGCAGATCTTTGTCAAGACCCTCACTGGCAAGACCATTACGCTTGAGGTGGAGTCATCC
GACACCATCGACAATGTGAAGGCAAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGTCTCATCTTCTGCTGGGCAAGCAGCTGGAGGACGG
CAGGACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTTGTGCTGCGTCTTCGAGGAGGCATGCAGATCTTTGTGAAGACCCTCACTGGG
CAAGACCATTACACTTGAGGTGGAGTCCTCGGACACCATAGACAATGTCAAGGCGAAGATCCAGGACAAGGAGGGCATTCCCCCGGGACCAGCAGCGCCT
CATCTTTGCTGGCAAGCAGCTGGAGGATGGCCGTACCCTTGCTGATTACAACATCCAGAAGGAGTCTACCCTTCACCTTGTCCTGCGTCTCCGAGGTGGT
ATGCAGATCTTTGTGAAGACCCTCACCGGCAAGACCATCACTCTGGAGGTTGAGAGCTCAGACACCATTGACAACGTCAAGGCCAAGATCCAGGACAAGG
AGGGCATCCCGCCGGACCAGCAGCGCCTCATCTTTGCTGGTAAGCAGCTGGAGGATGGCAGGACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCT
TCACCTTGTCCTGCGTCTCCGAGGTGGTATGCAGATCTTTGTGAAGACCCTTACCGGCAAGACCATCACTCTGGAGGTTGAGAGCTCAGACACCATCGAC
AACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGTCTCATCTTTGCCGGCAAGCAGCTGGAGGATGGTCGCACCCTCGCTG
ACTACAACATCCAGAAGGAATCCACTCTCCACCTGGTGCTCCGCCTCCGCGGTGGTCAGTAAATGCCCTGAGTACTCTGGTGGGTGCCCCTGTCGCTCGT
GTGAAGTGTTAAGTCTCGTTTGTGTCAAGTCCTACCGTGTCTGGTTTCATGGACCATCGAGTCCCTGTGAGATGTGTTGGTTTCGTTTAAACAGTTGTGA
GATGTGTTGGTTTCGTTTAAACAGTTGTGAGATGTGTTGGTTTCGTTTAAACAGTTGTGTGATGTGTTGGTTTCGTTTAAACAGTTGCTGCTATAGCAGT
ACGGTCAAGTATGAATAAGTGAACTTTGAACTAATCTGCCTATGCACATTTTACCTTCCGGTTAAAAAAAAAA
page-top