Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24947  (registered. 2003)
Contig Information
Length 1097 bp
Clones 48 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMV Shoot grown with continuous light after cold treatment 12
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit ATP synthase delta chain [Zea mays] >gi|219887163|gb|ACL53956.1| unknown [Zea mays]
Score 702
Evalue 6.63452e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24947
TTTTTTTTTTCAAAGGAAAATTACAAACACTTGAATTAAAAACTTTCCATGACCTCTCCTCATGTTTTTATCCATGTTTTTTGGCAGAAAGGAAATTAAA
GATTGTTCAGCGGGCTTCTTCCTAACCCACAAGACAAAATAAAACAGAGTGTCGTTCTCTTGTAAAGGTAAGCTTTTATTTCAAGACCACATCGAAGAAG
CAGACATGAGGGAACCTTCAGCGGCTCAGCCACTGCACTCTGGTGTTGATTTAGATCCGAAGGCGGTTAGATGTCAAAGGGTAGTCTCAAGAATGCCTCC
ATTTGCTTCGCCCTAGTCTTGATCGACATGTCAAACACCTTCTGCCCAAATTCAATCACCAGTCCTCCCATGATACTCTGGTCAATCTTTTGTTCAACCA
AGATGGTTTTGTCTTTCCCAAGGATATCACGCAAGGTCTCCTTAAGTTCTTTCTCCTCCTTATCAGGAAGTGGAACAACAGTCCTGACAACAACTTTCAC
CTCCCCCCTATGTGCCATGGTCAAATCAACAAATCTCTCAGCAATGCGCTCAACATATTTCAGTCTTCCATTGGATGCCAGTGCAGACAAGAATTTCTTT
GTGATGTCAGTAAACCCGGCTTCAGAGAATATTTCAGTTATAGCCTTCACCCTGGTTTCTTTAGGCACTGATGTGTCCTTCATGAATTGAGAAAACATAG
GGCTCTTCTTGGATGCCCCTACAACATCGAGAATCTCGGATTCAACTTTTTCCAACGAATTTGCGTTGGCTGCTGCAAGGAACAACGCACTAGCATAGTT
GCCGGTGCCACCATACAGAGCTTTTGGAACCTTGATCTTGTTCTCCTTAGGCTTATCCGCCTCCGTTGCCAGCCCCCTCGATACCTGAGCGACGGCCGCG
GATTCGTTGGCCGCGAGGCGAGCTTGGAGGAGCGGGAGGCCGGATGATGAGGTGCCGCGCCGCCATTTCCGGTTCGTTCCGCGGTGGTGGAGAGCGAAAC
CCTAGGAGGAGATCGGGTCGGGGAGAGGAGGAAGAGAGCGAGGCTGCGGGTCTCGTAGAATGCGATGAAAAAGGTGGGGGCGATGCGCAGTGGAGCG
page-top