Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24935  (registered. 2003)
Contig Information
Length 1516 bp
Clones 48 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 19
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 7
Homology (BLAST) Top Hit Os02g0101500 [Oryza sativa (japonica cultivar-group)] >gi|41052893|dbj|BAD07805.1| putative hydroxypyruvate reductase [Oryza sativa Japonica Group] >gi|41053227|dbj|BAD08188.1| putative hydroxypyruvate reductase [Oryza sativa Japonica Group] >gi|113535120|dbj|BAF07503.1| Os02g0101500 [Oryza sativa (japonica cultivar-group)] >gi|215695322|dbj|BAG90513.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1733
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24935
GCATATATAATATCTAGCATACATCACAACATAATTTGCCAAGCTTAATTTAGTAGCAAGCAGTGGGTATAAGGAATGCAGGGAAGGTCAGGGCAGGGCA
GGGAAACATATAATAAATGCATAACTGATAAAAAATCTCTTGCTTGATATATATACTCATTCATTCATTCAGTACTGCTACTCCATGAGGATGAGGGCAT
TCATACATATATACTGGTAAGGAGCTATATATGCATAGCATCTTAGCAAGTAGTAGTAGTAGTAGCAGTGATTCATCCATCTCTGCCTCTGCCTCTGCCT
AAAGCTTGGAAGATGGCAGGCCGAGTTGCTTGGCGTTAACGATGCTTGGGCAGGCAGGGGGCGGCGCCGCCTTCTCGTCGAGGAAGGGCTCCACCGTGTT
CGGGTTCCCCCACACCGGGTACCCCTTGATCTTACCAAGCACGTTCAGAGCAGCGAGCGTCGCCATCCCTTCACGCGTCCACTTCGATGCAGATGCGATG
TGAGGCACGACGACGGCATTCTTCATCTCAGCCAGCCCTGGCTTCATGTAAGGCTCATCCTCAAAAACATCGAGGCCAACACGGAACATGGGATTCGCCC
TCAGGTGCTCCACCAGTGCAACCTCGTCGATCACCGGGCCACGGCTGGCGTTCACCAGCACTGCCTCCTTCTTCATCATCGCCAGCCGCTCAGGGTTTAT
CAGGTGGTACGTCGTCTTGTCCAGCACTGGGTGCAGGCTTATCACATCGGCCTCCCTGAGAACTTCCTCCATGCTGGAGGCCCTCTTCCATGTCACAGGC
TGCTCACCATTGGCTTTCAGGAACTGGCCATACGCTGTGACGAATTTCTCGAGCCGTGTGGACTGGTACAGGTCGAAGTAGATCAAGTTCATCTTGAACC
CCTCAATCATCATCCTTGCATAAGCTGAGCCGATGCGGCCAGCTCCGATCACTCCAACAGTCTGCCCCTTGAGCAAGTTCCCAACAAACAAGTGCGGGAG
CCATCCGTCGTAGAGACCAGCCCTCATAAATTGGTCGGCCTCAACGATCCTCCGGGCAGCCGCCACCGACAGCGACGCCGCCAGCTCCGCCGTCGTCTCA
GTAAGAACACCAGGCGTGTTGCCGATGGCGATGCCATTCCTGTTGGCAGCATCGACATCAACGTTGTTGTAACCGACGGCCATGTTGCTGAAGGCTGTCC
CGCCGGCACGCTTGAGCGCAGAGAAGAGCACTTCCCCCCAGTCCTCTGTTAGCTGGCCGATGACACCATGGCAGTGATCACCGATGAGTGCCAGTATGTC
ATCAACAGAGAGGATGGTCTTCTTCTCCGTGCATATCTCGAGGCGGCAATCGTTGTCAGTGAGGAGCTTGATCCAGCGGGTGCCGGGCATGGACTTGGTG
CTCAGCCACACGGTACTTGCCGCTGGGGTTCCACACCTCTATCGATATCGGCTTCGCCATGGCTGGAGCAGGGGGGAGCAGCTGCAAGGAGGAGAAACAA
GAAGCTAGATGCAAGT
page-top