Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24930  (registered. 2003)
Contig Information
Length 845 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 9
Wh_RDr Root of dessiccated seed 11
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit cytosolic glutathione peroxidase [Triticum monococcum]
Score 867
Evalue 3.20335e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24930
GACCAGACAACAACACGATCCAATGAAAGGCACACCGAACAGCTACAATATTTGAATGCATTCATTAACACAACATATACAACAAGTACAGAGTAGGATG
CTGAAAATATAGCAGATGCATCCTCTGAAATGCTGGGTACAGATTTTATTTCAACACGACATTATTCTTGTTTCTAGAATACAGAGTGCCGATTTCTCTC
GAGGCTCCAGCCAGCGGCGGGTCTAAGAGCTCCCAAGCAGCTTCTTGATATCCTTCTCAATGCTTAGTGGGGAAGTGGTCGGGGCATAGCGGTCAACAAC
GTGACCCTCCTTGTCAACCAAGAACTTGGAGAAGTTCCACTTGATGCTGTCGCCGAAAAGGCCACCTTTGCTAGACTTCAGGAACTTGTACAGGGGGGAA
ACATTGCTGCCGTTGACATCAACCTTGTCGAAAATGGGGTACTCGGCCTTGAAGCGGGTGCAGGCAAACTGAACGATCTCATCATTGGTGCCAGGCTCCT
GCCCACCAAACTGATTGCATGGGAAAGCCAAGATCTCAAAGCCTTGGTCCTTGTACTTCGGGTACAGCTGGCTCAGCTCGGTGTAGTTGGAGTTGGTCAA
GCCACACTGGGATGCGACGTTAACAATGAGAAGAACCTTCCCCTTGTAGACGCTGAGGTCGACGTCCTTGCCGCTTGCATCCTTGACGGTGAAGTCGTGG
ACGGAGGTGGCGGACGACGCGGCGGCCATGGCGAGGTTCCCCGTGCGAGTTGACGGAGGCGGCGTCGGTGGCTGCGGCGGGGATCGACCGGGCTCAGAAC
TCAGGAGTAAGCGGGTAGTTGGGAGTTTGGGGGGAGGAGGCGCGG
page-top