Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24926  (registered. 2003)
Contig Information
Length 1530 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_KMP Shoot grown under continuous light 3
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 12
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VSCB Liquid cultured tissue 10
Homology (BLAST) Top Hit Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|48475219|gb|AAT44288.1| putative B2 protein [Oryza sativa (japonica cultivar-group)] >gi|51038049|gb|AAT93853.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579502|dbj|BAF17865.1| Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|218197041|gb|EEC79468.1| hypothetical protein OsI_20486 [Oryza sativa Indica Group]
Score 1361
Evalue 4.03957e-148
Total Hit Count 104
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24926
TGTGTGGGCGGAGCGAAGTGGGAGCCAACGCCAAGCCAGCCGAGCCGACTCCTATCCTCCTCTTCCCCTTCCCCGCAGCAGTTTCCCCAAATCCAGCGCC
CTCCCCGCCGGAATCCGGCGCCGAATCGAGCAGAGAGCTTGAACTGAGCTATGGACAACTTGTGGCATCTCGGAGATGAGTTCCGTGGGCAATCAAAGGT
GGTGGAGGACCGCCAATGGTCTCTCATGACATCAAAGCTTGCTGAGATCACAAAGTCAAAGGCTGAGAGGATGAATGACTTTGAGTATGCACGGATGAAC
ACCGTCCCTGATGTCAAGCAATGGGATAAGCTATCCTACCACCAAGAAGACAACAAGATGGACCACCTCAATCTTGGCTTGATGAACCTGGATCTTAAGA
TGAATGATCTCAAGATGAACGAGGCTGCCATGAAGTACCCTTTCCGCAACATGGCCTATAACATGAATCCGATGTACCCCAAGGGAAACAACGGTAATGT
CAATTCGTTCAAGATGAATGTTGGGGTCAACAAATATCCCAATAATCAGAATGGGAAGGAAACAAACGGCAAACACAATGGTGGTAACAACAACAATGGA
GGCAACAGCAACAACAACTCTGTTGACAAGCGCTTCAAAACATTGCCAACAAGCGAGATGCTACCGAGGAATGAAGTTCTTGGTGGATACATCTTTGTCT
GCAACAATGATACCATGCAGGAGGATCTCAAGAGACAGCTTTTTGGCTTGCCAGCAAGATATCGTGATTCAGTCCGAGCCATCACTCCTGGTCTACCTCT
TTTCCTCTACAACTACACGACCCATCAGCTACATGGGGTGTTTGAGGCTGCCAGTTTTGGAGGATCAAACATTGATCCCACTGCTTGGGAAGATAAGAAG
TGCAAAGGTGAATCCAGATTCCCAGCACAGGTGAGGATCCGCATTAGAAGGCTTTGCAAGGCCTTGGAAGAGGATGCTTTCAGGCCAGTGCTGCACCACT
ATGATGGTCCTAAATTCCGCCTGGAGCTCTCCATAGCAGAGACACTGTCACTGCTAGACCTGTGCAAGACAGAAGACGCCTGATCGGCTTCGGAACATGG
TTGTGGTTGCTCTGTGGTTCTTTTTAGTAAATATCATCCCTGTAAGTTGTGGAAGATGTTTTCACAATGATCTGTTCCGTCCTTCGTCCATGAAAGCGCA
AGCTGTTGGTTGGTGGTTGCATTTCCCCCAGAAAGGACCTGGTACTCGGAAGAAGTAGGCCTCTAAAGATGTGAGCCTGTCTGTGTCGGTGCCGTCTGTC
CGTAATCTTGGTGATGTGTATGTTCTTCTTCATATTTATGTATTTGTAGTGCAGTATGCCCGCCGTCAGCGGGGAAACCCCGAAAGACGGGGGATACTGT
TGTGATGCATCATGAATGCCCCAAAGTGAGGGCGGGTGATGTTGGGAGTGTACCCTTGTTGTCTTTGTACCTTACCTTGGTTTGGAAAGCTGGAACCTTG
CATTTGACTTGATGCTGCTGTTTCTGTGCC
page-top