Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24920  (registered. 2003)
Contig Information
Length 841 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 5
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 7
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit RecName: Full=40S ribosomal protein S15 >gi|125557476|gb|EAZ03012.1| hypothetical protein OsI_25153 [Oryza sativa Indica Group]
Score 695
Evalue 2.80027e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24920
TATATATATAAGCTCCCACTCTCACAAACCATTCTTCAGAACCCTAGAAGCCGCAGCTTCCCATTCCTCGCCGCCGCCGCCGCTTCGTACCCGCTCGAAG
CCGACCCGACCATGGCGGACGTCGACGTTGACACGGAGGTGGCCGCCGGCGCGCAGCCGAAGAAGAGGACGTTCCGCAAGTTCAGCTATCGCGGCGTGGA
TCTCGATGCCCTCCTCGACATGTCCACCGACGACCTTGTCCAGATGTTCCCCGCTCGCGCCCGCAGAAGGTTCAAGAGGGGTCTCAAGAGGAAGCCCATG
GCGCTCGTCAAGAAGCTGCGCAAGGCGAAAAAGGACGCTCCTGCTGGTGAGAAGCCTGAGCCAGTGAGGACACATCTTCGTAACATGATCATTGTCCCTG
AGATGATTGGCAGCCTTATCGGTGTCTACAATGGCAAGACCTTCAACCAGGTTGAGATTAAGCCTGAGATGATTGGCCATTACCTTGCAGAGTTCTCTAT
CTCCTACAAGCCAGTGAAGCATGGTAGGCCCGGTATTGGTGCCACACACTCTTCCCGGTTCATTCCTCTTAAATGAGTTATGCCGCTTTCTACTTTGAAA
GAATTCAGTACGGACCATCTGGTGGCATGTCCATCTAGCTGTCTCCCTTGTTTTGAACCAGTTATATATCTAGTATTTGGTTCTGTTTAGCTATAATTTC
GTTATGCACAATGAGCTGTTCTACCTAAATGCTCTGAGAATCTTGTTTCCATTGTGAAGGTTCATTTTGATTCATGCTGTGCTTGTCAGTTTGTGAGATT
TTTACTATGAAATGCACACTTTTTGATTGGTAAAAAAAAAA
page-top