Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24915  (registered. 2003)
Contig Information
Length 760 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit Os02g0284600 [Oryza sativa (japonica cultivar-group)] >gi|47847708|dbj|BAD21487.1| putative 60S ribosomal protein L27 [Oryza sativa Japonica Group] >gi|47848339|dbj|BAD22201.1| putative 60S ribosomal protein L27 [Oryza sativa Japonica Group] >gi|113536101|dbj|BAF08484.1| Os02g0284600 [Oryza sativa (japonica cultivar-group)] >gi|125538995|gb|EAY85390.1| hypothetical protein OsI_06769 [Oryza sativa Indica Group] >gi|125581675|gb|EAZ22606.1| hypothetical protein OsJ_006089 [Oryza sativa (japonica cultivar-group)] >gi|215768337|dbj|BAH00566.1| unnamed protein product [Oryza sativa Japonica Group]
Score 584
Evalue 1.72149e-58
Total Hit Count 317
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24915
TTTTTTTTTTTGGGACGCAACAGACAGCATATCTCAAGAAGTAATAACACTGAACAAAATTCCAACAAAGATCTATTCTTCACATGATTTAACACATGAA
ACATCATCATATCTCATAAGATCCAAGCTAAACACAGAGTCTTCTTCATGGGCAATACCAAAACAGGACACCTTAAGCGCAGCAACAGTCACCGATAACA
AGCAACTAAAAATGTAAAGGGTTCGGGTAGTAATAACGGCAGAGACCGCCCTGGCGCGGCCGGCCGGCCTAGAAGCGGAGCTTGGTGAAGAACCACCTGT
TCTTGCCGGTCTTGAACCTCTCCTCGAGCTTGGCCTTGGCGGCCTTGGCGGCGCCCACCTTCTTGTCCTTGGAGGTGAGGGAGTCGGGCGCGCCGGAGGC
CACCTCCTTGAGGTCGACGTCGAGGGTATAGCGGGTGGGCATGAGATGGGTGAAGTTGACGAGCTTGAGGAACACCTTGACGCGGGACTTCTTGGCCGTC
TTCTTGGCCGAGTCCTTGCGGATCACCTTCTTCGGGTACTTGGCCAGCCCGGCGACGAGGCAGTGCCCGTACGGGCGGTCGCGGGTGCCCTCCTCGAACA
CGCGCACGATCACCGCCTTCTTCCCCGCGTACCTGCCCTGCAGCAGGATCACCGCCTTGCCGGGCTTCAGGAACTTCACCATCTTCGCTTCCTTCCTCAA
GCTGCGCTGCGCCGCCGCCGGTGGGTTGGGGGAGGGGAGGGGAGGGGAGGGGTCTGTGGG
page-top