Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24912  (registered. 2003)
Contig Information
Length 851 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 26
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PW9, chloroplastic; Short=RuBisCO small subunit PW9; Flags: Precursor >gi|170771|gb|AAA34302.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 860
Evalue 2.10441e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24912
CCTCGTGCCGGGCCTAGCTAGCTATCGCCTCCCCACCTAGCAATTTACGTACTCCGCCATGGCCCCAGCCGTGATGGCTTCTTCCGCCACCACCGTCGCG
CCCTTCCAGGGGCTCAAGTCGACCGCCGGCCTCCCCATCAGCTGCCGCTCCGGCAGCACCGGCCTCAGCAGCGTCAGCAATGGCGGAAGGATCAGATGCA
TGCAGGTGTGGCCAATTGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCTTGAAGCAGGTCGACTACTTGAT
CCGCTCCAAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGTCGATACTGGACA
ATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACACAGGTGCTCAACGAGGTGGAGGAGGTTAAGAAGGAGTACCCTGATGCGTATGTCCGCGTCA
TCGGCTTCGACAACATGCGCCAGGTGCAATGCGTCAGCTTCATTGCCTTCAGGCCACCAGGCTGCGAGGAATCCGGCAAGGCCTAAAGTGCAAGTTGAAG
TAACCGATATACATGTCATGTTAGTCAAATTTGTCGGCGGCTCTGCTTTCTCAGTTTTACTTCTCGTTCTACTCATATGTGAATATATGAGCATATGTAT
GTAAGCACCTACCAATGTAGGTCGAGGAGGATGCATATGAGAATTATAGCACCGGCTATACATATACATATATATTATATGCAATCAACGGATTAGTGTC
TTGCCGTCAATTGATGGAAATGTTACTTTCTTTGCAGCCGGAAAAAAAAAA
page-top