Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24907  (registered. 2003)
Contig Information
Length 1011 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 5
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 8
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os05g0169100 [Oryza sativa (japonica cultivar-group)] >gi|122169494|sp|Q0DKF0|RL102_ORYSJ 60S ribosomal protein L10-2 (Putative tumor suppressor SG12) (Protein QM1) >gi|158513181|sp|A2Y0T4|RL102_ORYSI 60S ribosomal protein L10-2 (Putative tumor suppressor SG12) (Protein QM1) >gi|1293784|gb|AAA98698.1| similar to human QM protein, a putative tumor supressor, and to maize ubiquinol-cytochrome C reductase complex subunit VI requiring protein SC34 >gi|113578310|dbj|BAF16673.1| Os05g0169100 [Oryza sativa (japonica cultivar-group)] >gi|215694643|dbj|BAG89834.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767618|dbj|BAG99846.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1075
Evalue 3.27664e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24907
TTTTTTTTTTGGACAACAACCACAGCAAAATACATTGACAAACGAATTCAAGCAGCAATGATTCAACAGGCCATTCATATTAGTACCATCATCACAAAAT
AGATAATATCTTCCATAACAAGGTTCGACACAACATTCAGACAAAATAACATAGCACCACAGGCACTTGGAATCTAAGTTCCACACGGTAAAATAAGTTG
CGATAGAACGGATAGACTTCTGCTAGATTATGCGGCAGACAGGAAAGCTTGTCCAGGGGCACGGTTCGCCAGGCGGCCATGGCATCCGAGCAGCTTCGCG
TTGACTCCATCAGGCAAGATCCTGCCCTCACTCTTGAACTTGAGGTAGTCATTGCGGTTGAACTTGGTGAAGCCCCACTTCCTGCTCTCAATGATCTTTT
GGCGGCCAGGGAACTTGAACTTGGCACGACGAAGGGCCTCAGTGGCATGGATGGCATTGTTGGGCTTGCACCGCACAGAAAGGAGGACCTGCCCAATGGC
AACACGGGCACAGACTCCCTGCGGCTTCCCAAAAGCACCCCTCATACCAGTCTGGAGCCTATCAGCCCCGGCGCACGAAAGCATCTTGTTGATACGGAGC
ACATGGAACGGGTGAACCCTGACCCTGAGGTGGAAGGCATCCTTTCCTGCATGCTTGGTCATGTACTTGTTGCAAGCAATACGGGCAGCCTCAAGAGCCT
CACTGGACACATTCTCCTTCTCCCATGAGACAAGGTGAACACAGTGAGAGAACTCATCGACACCCTTCTTCTTCATGCCAACATCATAGATCCTGATCTT
AGGGTCAGGCACACCACGGCAGTACCTTGACTTGGGGTACGGCTTGTTCTTGATCTGCCGATAGCACCTCGCAGGTCTTCTCCCCATGGCGACGGCGGCT
CGAGGCAGGCGGCGGCTGCGGCGGCGGCGGGAGGAGACGGAAGAGCTGCGATCTAGGGTTTGGTGTGGATCGACGGGGCCGCTTATATAGAGGTGGGGAT
TGCGAATGGGT
page-top