Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24903  (registered. 2003)
Contig Information
Length 2070 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 14
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 11
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 18
Homology (BLAST) Top Hit TCER1 [Triticum aestivum]
Score 2574
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24903
CACTGATAAATCTTACAGACTTAGCTGTCCGACCAAACAGATCTCCTGCGTGTTCCCGAAAGAAAAGAAAAAAAGGCTGCGGTTTTAGCATAAATTCTCG
GTAGTACCATCTTAGCAACATTTCCCAAGTCAAGCTTTCGTGAGAGGGACGAAGCCGTGCCTGATAGCAGCCGACCATGCCTTCTCAGGGTCCATCATGT
CGTCACCGCACTCGTGCACGCTCCACCCTTCCAGGACGTGAAGTATTCCGGCGATATGCCACGCGCTCATCACCCTTCTCGGCAGCCAGTTCTCGCAGGA
GTGGATGTTCTGCATGGTGTCCGGGATCTTCATCGCCGGAGTGCTCAAGTAAGTGCAGTCCTTGCGGACTTTCTTAAGGGGGAACTGCGATATTGGAATG
AACACTGTTCCTTTTGGTGCCATCCTCTGTTCTTTGTCGTCGATCCTCTCTACTAGCCAAATCTTGGTTATGTCATTGCTGGAGCACTTCAAGTAGCTTG
CTCTGTTCTCTGGCATCTGTGACTTGAGCATGTCATACTCTTTCTTACGATTCATGATCACCTGGATGCCCTTGCCACATAAAGCCATAGCAACGGCACG
GGCTATCTTAGAAGTCCCTGTATGAAGAAAAACTTGCTTTGCATCTGAAGGGATGCTTTTTAGGACAACTCCAGTTGCTAAGCCACTTCCATCAACAATT
CGAACTCCTAATTTTGGGTATTTTTGTCTAAATAGTTCACCATTCCCATTGAGCTGTTTTGCCTGATTTAGTAGCCCTAGGCTGAGCACCTTAACCCCTC
TTACATCAGCATCCAATATCGCCTTTTCAATTAAGTCGTTGATCGATTCTCTATCCCATGTTAGACCATATTGGAAGTTGTATCTCGGTACGACCCATGT
TTGCATCTTCATCTTCTTCAGTTTGATTCTCTCGACCACGAATGCAGATGACCCATAAATCCATGCTACCACCATTGACAGCCATGCCAAGGGCCATAGC
GTCCACATATACCACTCGGAGTTATCAGATGGTTTGGATGCTATGGAGGCGAATCCAACCCTTAGATGATAAGCCGATTGCAAGTTGGTCATATGTGTGA
GATGAACAAGGTCAGGTGTCTCCTCTGTCCCTTTCAGTGAGCTCTCATACAGCTCGTCAGATGCCTTGTCCATAGTGCTGTATATGTAGTCGTAAAATGG
CATGAAGAGTGAATAGTTTGTGCGGAACTGCGTGTGGTGAAGGGAATGAAACGATGGGGTGTACATGAGGTACTTGAGAGGAGGAAAGACTTGGAACATC
CACTTTGGCACCAACTCAAAGTTGCAGTGCCCCATGTTGTTCATGAAGTCAATGTAAACGATATACAGCACAAACACGAGGGCGGAGCCATTTCCCATAT
AAACTGTGGACAACATCGGGATTGCAAAGAGCGTGAAATAGACAATGTGTTCGCCAAAAGGATGGATGACCGAGGTGATGGGCTCGGTGACGATGGAGGC
GTGGTGGTGGGAGTGGTAGCGCGAGTAGAGGAAGTGGTGGTGCAGCGCGCGGTGGAACCAGTAGTAGAGGAACTCCACGGGCCCCGCGTGCAGCAGCGCA
TGTTGCCACCGCCCCGTCCGTCCGCCACAGCGGGAACCTCCGCACGCTCGGCATCGCCAGGTACCCCACGTAGAAGAGCAGCCCGTTGAAGACGATCTGG
TCGTCCCATCCGCGCTCGCGGTCCACCTGCTCGAACTCGATGTCCCGGTCCACGATGCGGTGCTTGCTGCGCGCGGTCTGGTAGCGGGACAGGCTGATCC
AGATCTGGTTGTGGATCATCCGCAGCGCCAGCGACGGCAGGATCAGCGAGTAGGCCAGGTCGATGTCGCCCCACCCCTTGTTCATCACCCGGTACGCGCC
GTGGACGACCACCGGCGCCATCACCAGGTACTTGAAGTTGCCCATCCTCTGCCACGGCCATTCAGTCAAAGGCCCCGGCCTGGTCGCCATGGCTGGCTGT
GGTCGCCTCCTTCCTTCCTTCCTTCCTTCCCACCCGGCCACCCCAATGGCCAATCAGAAGGAAGATGGTA
page-top