Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24893  (registered. 2003)
Contig Information
Length 1376 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 7
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 5
Homology (BLAST) Top Hit RecName: Full=Phosphoglycerate kinase, chloroplastic; Flags: Precursor >gi|21833|emb|CAA33303.1| unnamed protein product [Triticum aestivum] >gi|3293043|emb|CAA51931.1| phosphoglycerate kinase [Triticum aestivum]
Score 1677
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24893
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAACATCCTCAACCAACATCATTCCATCTTTGCCTTATAAATAAAACATTTG
CTGGTGCTAATTATGTGAGCTAAGAAAGGGCAACTCAAGTGAGCACAAATTGCTGGGGGTGTTATTCAAACAGTTCCCAGTATTTCTCTATAAAACATTG
GTCTCTTACATTTCGAGTGGTCGAAGACGAGCAAAAGAGGGAGGACAACATGGCAGGTTTGGAACGGTACATGAAAGGAATTAAGATGCAACAAATGAAG
CTTAGCCTCATACGGTCACCGACCTCGTCATGACACCTTCATCAAGTGCAACGACTCCAGGAAGCTCCTTTCCTTCCAACAACTCCAAGCTGGCGCCACC
ACCAGTTGAGATGTGGCTCATAACATCAGCCACTCCCACCTTCTCAACAGCCGCAACGGAGTCTCCGCCTCCAATGATAGTTGTCACACCCTTTTTGCTA
AGCTCGGCCAACTTCTTTGCAATAGACTCAGTTCCTACTGCAAACTTGTCAAATTCAAAGACACCCATTGGTCCGTTCCAAATGATTGTCTGTGTTGTGT
CCAGGGCATCATTAAATGTTTTGACTGAATCTGGGCCAATGTCCAGCCCCATCCAACCATCAGGAATTGCAGATGCAGGGACGGTCTGACTGTTAGCATC
AGGAGCAAACTTATCAGCAATGATAACGTCAGATGGCAACAGAAGGGAGACACCCTTTGCCTTTGCCTTTGCAAGGAGAGATGTTGCCAGCTCAAGTTTA
TCTTCCTCAACCAAGGAAGAACCAACTGAGAGTCCTTGTGCCTTGTAAAATGTGAAGATCATACCACCACCCAAAAGAAGGATGTCACACTTCTCCAACA
GGGATTCGATAACCCCAATCTTGGATGACACCTTTGAGCCACCCACAATGGCAGCAAATGGGCGCTTAGGGTTTGAAACAGCTCCATCCAGGTAGTCAAG
TTCCTTCTGCAAAAGGAATCCAGCAACAGAAGGCTTCAAGAACTTGGTAACTCCCTCAGTCGAGGCATGTGCTCTGTGGGCTGTTCCGAATGCATCGTTT
ACAAACAGATCTGCCAGTGACGCAAGCTTCTTTGCAAACTCTGGGTCATTCTTCTCCTCTTCCTTGTAAAATCTTACGTTTTCCAGGAGCAAAACAGCAC
CATTTGCCAGGTCAGCCACCAATTTCTCAACTTCTGGGCCGATAACATCTTCTGCTTTTTTCACCTCAATGCCAAGAAGCTCGGATAATCGGGGCACAAG
GGGAGCCAAGCTAAACTTAGGAGTAACACCCTTAGGACGACCCAGGTGGCTGGTGAGGATGACCTTGGCGCCGTGC
page-top